\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821069859:

Variant ID: vg0821069859 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21069859
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGTGTGCCGACGGAGGCAGCGGAGGACGGCGGCAGCCTAAGTGTCGACAGCCGGTCCTAGACGGGAGAAGGTGGCTCCGACGGAGGTGGTCTGGTAGGC[G/A]
GCGACGGCCTAGGAGTCCGGGTGGAAGTCCTCGTCGACAGCGGTGGTGACCTGGGACGGCGACGCTAGCGCTGGTGCAAGGGTCTCAGCAAGGAGAGGCA

Reverse complement sequence

TGCCTCTCCTTGCTGAGACCCTTGCACCAGCGCTAGCGTCGCCGTCCCAGGTCACCACCGCTGTCGACGAGGACTTCCACCCGGACTCCTAGGCCGTCGC[C/T]
GCCTACCAGACCACCTCCGTCGGAGCCACCTTCTCCCGTCTAGGACCGGCTGTCGACACTTAGGCTGCCGCCGTCCTCCGCTGCCTCCGTCGGCACACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 4.00% 0.02% 0.00% NA
All Indica  2759 97.90% 2.10% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 58.00% 42.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 3.10% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821069859 G -> A LOC_Os08g33730-LOC_Os08g33740 intergenic_region ; MODIFIER silent_mutation Average:80.024; most accessible tissue: Zhenshan97 panicle, score: 92.904 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0821069859 G A -0.01 -0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821069859 5.06E-06 NA mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821069859 NA 5.61E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821069859 NA 3.92E-07 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821069859 NA 8.62E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821069859 9.75E-09 NA mr1134_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821069859 NA 1.07E-09 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821069859 1.55E-06 NA mr1504_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821069859 NA 1.14E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821069859 NA 2.11E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251