Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821047605:

Variant ID: vg0821047605 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 21047605
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAATTTTGTTAAGATACAGAGATATAAAAATATATATGTGTTGCATTGACACCAAAATTATATTTTACTCCAGTTAGATGAATAGATTGGTATTACTA[T/A]
AATTCTGGTATAGAGCATATTAGGGAGGTGTTTGGTTTGTAAGTTTATCAATTTTGTTTGGAGTAAATTTCACAAAACTATAGGTACTTTGGTCAAATTA

Reverse complement sequence

TAATTTGACCAAAGTACCTATAGTTTTGTGAAATTTACTCCAAACAAAATTGATAAACTTACAAACCAAACACCTCCCTAATATGCTCTATACCAGAATT[A/T]
TAGTAATACCAATCTATTCATCTAACTGGAGTAAAATATAATTTTGGTGTCAATGCAACACATATATATTTTTATATCTCTGTATCTTAACAAAATTTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.00%	27.80%	0.08%	0.04%	NA
All Indica	2759	99.00%	0.80%	0.11%	0.07%	NA
All Japonica	1512	22.70%	77.20%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.20%	0.17%	0.17%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.10%	0.80%	0.11%	0.00%	NA
Indica Intermediate	786	98.50%	1.30%	0.13%	0.13%	NA
Temperate Japonica	767	3.50%	96.30%	0.13%	0.00%	NA
Tropical Japonica	504	48.60%	51.40%	0.00%	0.00%	NA
Japonica Intermediate	241	29.50%	70.50%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0821047605	T -> A	LOC_Os08g33710.1	upstream_gene_variant ; 2867.0bp to feature; MODIFIER	silent_mutation	Average:73.627; most accessible tissue: Minghui63 root, score: 93.342	N	N	N	N
vg0821047605	T -> A	LOC_Os08g33700.1	downstream_gene_variant ; 353.0bp to feature; MODIFIER	silent_mutation	Average:73.627; most accessible tissue: Minghui63 root, score: 93.342	N	N	N	N
vg0821047605	T -> A	LOC_Os08g33700-LOC_Os08g33710	intergenic_region ; MODIFIER	silent_mutation	Average:73.627; most accessible tissue: Minghui63 root, score: 93.342	N	N	N	N
vg0821047605	T -> DEL	N	N	silent_mutation	Average:73.627; most accessible tissue: Minghui63 root, score: 93.342	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0821047605	7.15E-12	1.97E-18	mr1410	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821047605	NA	1.38E-15	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821047605	NA	2.04E-30	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821047605	NA	1.95E-09	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821047605	3.29E-09	8.95E-17	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821047605	NA	7.16E-15	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821047605	NA	2.18E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821047605	NA	6.33E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251