\
| Variant ID: vg0820991239 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20991239 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCATATTATTCATTGTATATGTTAATGCCTTAAGTTACTTATATTTAGCTATTTAGTATATTTTTATTGTAAGAAGTGTCTCTACAGAGTTTAAAGTGTC[T/A]
CAAGAAAATGTCTTTACATGTCAGACACATTTTAAAGTGCCGAAAGAGTACCTCTACAAGATATAAAATCTAATAAAATATGCTGAAAATATTTCGAGAC
GTCTCGAAATATTTTCAGCATATTTTATTAGATTTTATATCTTGTAGAGGTACTCTTTCGGCACTTTAAAATGTGTCTGACATGTAAAGACATTTTCTTG[A/T]
GACACTTTAAACTCTGTAGAGACACTTCTTACAATAAAAATATACTAAATAGCTAAATATAAGTAACTTAAGGCATTAACATATACAATGAATAATATGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 47.40% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 87.70% | 12.10% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 1.20% | 98.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.40% | 15.10% | 0.50% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.20% | 13.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.50% | 13.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 97.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 65.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820991239 | T -> A | LOC_Os08g33610-LOC_Os08g33620 | intergenic_region ; MODIFIER | silent_mutation | Average:29.205; most accessible tissue: Callus, score: 61.527 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820991239 | NA | 2.72E-18 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.74E-29 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.23E-44 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 3.90E-26 | mr1551 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 8.59E-19 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 8.34E-29 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.94E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 5.06E-67 | mr1970 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.27E-84 | mr1973 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.76E-51 | mr1063_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 2.11E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 5.95E-15 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.25E-21 | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.11E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 6.19E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 4.30E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 2.72E-34 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.52E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 5.40E-11 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 9.53E-17 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.33E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 7.69E-08 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 2.54E-26 | mr1323_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.74E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | 5.04E-07 | 1.09E-26 | mr1401_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 3.68E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 9.81E-25 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 6.44E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.08E-14 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.81E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 2.04E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.04E-45 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | 6.35E-06 | NA | mr1511_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 5.72E-14 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 5.58E-08 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | 4.44E-06 | 3.94E-06 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.91E-58 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 5.99E-35 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 3.60E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 6.24E-30 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 4.43E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 6.78E-16 | mr1744_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 7.70E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | 2.80E-06 | 1.29E-13 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | 5.26E-06 | 5.26E-06 | mr1781_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.03E-48 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 3.19E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.20E-30 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | 2.76E-06 | NA | mr1828_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 7.38E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | 8.64E-06 | 2.37E-06 | mr1915_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.65E-20 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 5.32E-21 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 3.59E-06 | mr1930_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 4.61E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.30E-26 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.13E-64 | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820991239 | NA | 1.12E-100 | mr1973_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |