Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820969276:

Variant ID: vg0820969276 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 20969276
Reference Allele: CT	Alternative Allele: C,CTTT,AT,CTT
Primary Allele: CT	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGATTGCCATGTAAACCCTTCACATGGATCAATTAACCCTGTTCCCAGGTGGATCAGACAAAACCAAGGCTCCATACCCTACTAATATAATCATTTGTT[CT/C,CTTT,AT,CTT]
TTTTTTTATTTAGAGCATGTAGAATAATAAAAGTTAACTTTTAGCTATGGATCAATAAAGTTCATATCACCTGCAGCTAATTTAGCTACGTTTGTACAAT

Reverse complement sequence

ATTGTACAAACGTAGCTAAATTAGCTGCAGGTGATATGAACTTTATTGATCCATAGCTAAAAGTTAACTTTTATTATTCTACATGCTCTAAATAAAAAAA[AG/G,AAAG,AT,AAG]
AACAAATGATTATATTAGTAGGGTATGGAGCCTTGGTTTTGTCTGATCCACCTGGGAACAGGGTTAATTGATCCATGTGAAGGGTTTACATGGCAATCAT

Allele Frequencies:

Populations	Population Size	Frequency of CT(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	17.00%	0.11%	0.00%	AT: 0.15%; CTTT: 0.11%; CTT: 0.02%
All Indica	2759	96.30%	3.30%	0.04%	0.00%	AT: 0.25%; CTT: 0.04%
All Japonica	1512	70.20%	29.50%	0.26%	0.00%	NA
Aus	269	25.30%	72.90%	0.00%	0.00%	CTTT: 1.86%
Indica I	595	98.20%	1.30%	0.17%	0.00%	AT: 0.34%
Indica II	465	97.20%	2.40%	0.00%	0.00%	AT: 0.43%
Indica III	913	96.80%	3.00%	0.00%	0.00%	CTT: 0.11%; AT: 0.11%
Indica Intermediate	786	93.90%	5.90%	0.00%	0.00%	AT: 0.25%
Temperate Japonica	767	74.20%	25.40%	0.39%	0.00%	NA
Tropical Japonica	504	58.90%	41.10%	0.00%	0.00%	NA
Japonica Intermediate	241	81.30%	18.30%	0.41%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820969276	CT -> C	LOC_Os08g33580.1	downstream_gene_variant ; 1915.0bp to feature; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> C	LOC_Os08g33590.1	downstream_gene_variant ; 4982.0bp to feature; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> C	LOC_Os08g33580-LOC_Os08g33590	intergenic_region ; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> CTTT	LOC_Os08g33580.1	downstream_gene_variant ; 1916.0bp to feature; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> CTTT	LOC_Os08g33590.1	downstream_gene_variant ; 4981.0bp to feature; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> CTTT	LOC_Os08g33580-LOC_Os08g33590	intergenic_region ; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> AT	LOC_Os08g33580.1	downstream_gene_variant ; 1914.0bp to feature; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> AT	LOC_Os08g33590.1	downstream_gene_variant ; 4983.0bp to feature; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> AT	LOC_Os08g33580-LOC_Os08g33590	intergenic_region ; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> CTT	LOC_Os08g33580.1	downstream_gene_variant ; 1916.0bp to feature; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> CTT	LOC_Os08g33590.1	downstream_gene_variant ; 4981.0bp to feature; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N
vg0820969276	CT -> CTT	LOC_Os08g33580-LOC_Os08g33590	intergenic_region ; MODIFIER	silent_mutation	Average:48.474; most accessible tissue: Callus, score: 92.87	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820969276	NA	7.08E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	6.22E-07	3.80E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	1.12E-15	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	1.46E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	1.32E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	4.75E-10	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	6.17E-06	1.10E-06	mr1046_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	2.33E-06	2.33E-06	mr1048_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	5.10E-06	5.10E-06	mr1054_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	6.93E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	6.03E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	8.35E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	1.09E-06	mr1230_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	2.10E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	6.97E-06	5.23E-07	mr1283_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	3.14E-06	mr1288_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	8.26E-06	8.25E-06	mr1290_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	5.09E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	4.96E-06	mr1305_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	5.45E-06	3.18E-07	mr1345_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	2.46E-06	mr1351_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	3.14E-06	3.14E-06	mr1357_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	3.50E-07	3.50E-07	mr1365_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	4.07E-06	4.07E-06	mr1370_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	4.85E-06	4.85E-06	mr1372_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	3.07E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	4.04E-07	2.62E-08	mr1381_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	1.66E-26	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	9.13E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	2.70E-06	mr1409_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	6.62E-07	2.58E-17	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	2.00E-15	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	1.74E-06	mr1421_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	4.63E-25	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	2.38E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	2.62E-06	3.87E-07	mr1432_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	2.81E-06	mr1447_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	4.04E-06	4.04E-06	mr1459_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	5.86E-07	5.86E-07	mr1512_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	1.99E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	5.61E-06	2.55E-07	mr1554_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	6.54E-06	1.59E-06	mr1555_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	6.98E-07	6.98E-07	mr1573_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	5.43E-15	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	9.02E-06	9.02E-06	mr1575_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	5.85E-06	5.85E-06	mr1591_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	1.71E-06	mr1594_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	9.95E-06	7.52E-07	mr1637_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	5.71E-06	5.71E-06	mr1643_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	3.24E-06	mr1649_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	4.31E-06	mr1661_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	8.38E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	6.26E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	3.46E-07	3.46E-07	mr1704_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	7.85E-06	7.85E-06	mr1710_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	6.70E-06	mr1713_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	3.08E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	3.25E-06	3.25E-06	mr1765_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	3.67E-06	1.09E-06	mr1785_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	3.67E-06	3.67E-06	mr1804_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	2.90E-06	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	7.84E-07	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	2.37E-06	2.37E-06	mr1869_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	1.84E-11	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	9.56E-06	mr1916_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	9.70E-12	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	3.03E-07	3.03E-07	mr1941_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276	NA	3.54E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251