\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820969276:

Variant ID: vg0820969276 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 20969276
Reference Allele: CTAlternative Allele: C,CTTT,AT,CTT
Primary Allele: CTSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGATTGCCATGTAAACCCTTCACATGGATCAATTAACCCTGTTCCCAGGTGGATCAGACAAAACCAAGGCTCCATACCCTACTAATATAATCATTTGTT[CT/C,CTTT,AT,CTT]
TTTTTTTATTTAGAGCATGTAGAATAATAAAAGTTAACTTTTAGCTATGGATCAATAAAGTTCATATCACCTGCAGCTAATTTAGCTACGTTTGTACAAT

Reverse complement sequence

ATTGTACAAACGTAGCTAAATTAGCTGCAGGTGATATGAACTTTATTGATCCATAGCTAAAAGTTAACTTTTATTATTCTACATGCTCTAAATAAAAAAA[AG/G,AAAG,AT,AAG]
AACAAATGATTATATTAGTAGGGTATGGAGCCTTGGTTTTGTCTGATCCACCTGGGAACAGGGTTAATTGATCCATGTGAAGGGTTTACATGGCAATCAT

Allele Frequencies:

Populations Population SizeFrequency of CT(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 17.00% 0.11% 0.00% AT: 0.15%; CTTT: 0.11%; CTT: 0.02%
All Indica  2759 96.30% 3.30% 0.04% 0.00% AT: 0.25%; CTT: 0.04%
All Japonica  1512 70.20% 29.50% 0.26% 0.00% NA
Aus  269 25.30% 72.90% 0.00% 0.00% CTTT: 1.86%
Indica I  595 98.20% 1.30% 0.17% 0.00% AT: 0.34%
Indica II  465 97.20% 2.40% 0.00% 0.00% AT: 0.43%
Indica III  913 96.80% 3.00% 0.00% 0.00% CTT: 0.11%; AT: 0.11%
Indica Intermediate  786 93.90% 5.90% 0.00% 0.00% AT: 0.25%
Temperate Japonica  767 74.20% 25.40% 0.39% 0.00% NA
Tropical Japonica  504 58.90% 41.10% 0.00% 0.00% NA
Japonica Intermediate  241 81.30% 18.30% 0.41% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820969276 CT -> C LOC_Os08g33580.1 downstream_gene_variant ; 1915.0bp to feature; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> C LOC_Os08g33590.1 downstream_gene_variant ; 4982.0bp to feature; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> C LOC_Os08g33580-LOC_Os08g33590 intergenic_region ; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> CTTT LOC_Os08g33580.1 downstream_gene_variant ; 1916.0bp to feature; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> CTTT LOC_Os08g33590.1 downstream_gene_variant ; 4981.0bp to feature; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> CTTT LOC_Os08g33580-LOC_Os08g33590 intergenic_region ; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> AT LOC_Os08g33580.1 downstream_gene_variant ; 1914.0bp to feature; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> AT LOC_Os08g33590.1 downstream_gene_variant ; 4983.0bp to feature; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> AT LOC_Os08g33580-LOC_Os08g33590 intergenic_region ; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> CTT LOC_Os08g33580.1 downstream_gene_variant ; 1916.0bp to feature; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> CTT LOC_Os08g33590.1 downstream_gene_variant ; 4981.0bp to feature; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N
vg0820969276 CT -> CTT LOC_Os08g33580-LOC_Os08g33590 intergenic_region ; MODIFIER silent_mutation Average:48.474; most accessible tissue: Callus, score: 92.87 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820969276 NA 7.08E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 6.22E-07 3.80E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 1.12E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 1.46E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 1.32E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 4.75E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 6.17E-06 1.10E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 2.33E-06 2.33E-06 mr1048_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 5.10E-06 5.10E-06 mr1054_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 6.93E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 6.03E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 8.35E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 1.09E-06 mr1230_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 2.10E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 6.97E-06 5.23E-07 mr1283_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 3.14E-06 mr1288_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 8.26E-06 8.25E-06 mr1290_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 5.09E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 4.96E-06 mr1305_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 5.45E-06 3.18E-07 mr1345_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 2.46E-06 mr1351_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 3.14E-06 3.14E-06 mr1357_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 3.50E-07 3.50E-07 mr1365_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 4.07E-06 4.07E-06 mr1370_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 4.85E-06 4.85E-06 mr1372_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 3.07E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 4.04E-07 2.62E-08 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 1.66E-26 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 9.13E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 2.70E-06 mr1409_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 6.62E-07 2.58E-17 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 2.00E-15 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 1.74E-06 mr1421_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 4.63E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 2.38E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 2.62E-06 3.87E-07 mr1432_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 2.81E-06 mr1447_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 4.04E-06 4.04E-06 mr1459_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 5.86E-07 5.86E-07 mr1512_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 1.99E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 5.61E-06 2.55E-07 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 6.54E-06 1.59E-06 mr1555_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 6.98E-07 6.98E-07 mr1573_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 5.43E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 9.02E-06 9.02E-06 mr1575_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 5.85E-06 5.85E-06 mr1591_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 1.71E-06 mr1594_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 9.95E-06 7.52E-07 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 5.71E-06 5.71E-06 mr1643_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 3.24E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 4.31E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 8.38E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 6.26E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 3.46E-07 3.46E-07 mr1704_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 7.85E-06 7.85E-06 mr1710_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 6.70E-06 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 3.08E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 3.25E-06 3.25E-06 mr1765_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 3.67E-06 1.09E-06 mr1785_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 3.67E-06 3.67E-06 mr1804_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 2.90E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 7.84E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 2.37E-06 2.37E-06 mr1869_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 1.84E-11 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 9.56E-06 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 9.70E-12 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 3.03E-07 3.03E-07 mr1941_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820969276 NA 3.54E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251