Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0820968196:

Variant ID: vg0820968196 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20968196
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTATATTTGAATTCTCAAAAACAATTTGAAGTTTTACTAAAAATCTACTTTCACTCTATGTTGAAACCTCGAAGTTACTCCCTCCATACTTACAAAGGAA[G/A]
TCGTTTAGGATAATGTTTAAGTCAAACCTTGGGAATATAAATCATGAATAACTCTCAAGTTGTTGAGTTTGAAAATGTAAAACTTATATGAATATATTTG

Reverse complement sequence

CAAATATATTCATATAAGTTTTACATTTTCAAACTCAACAACTTGAGAGTTATTCATGATTTATATTCCCAAGGTTTGACTTAAACATTATCCTAAACGA[C/T]
TTCCTTTGTAAGTATGGAGGGAGTAACTTCGAGGTTTCAACATAGAGTGAAAGTAGATTTTTAGTAAAACTTCAAATTGTTTTTGAGAATTCAAATATAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.90%	17.00%	0.08%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	51.50%	48.30%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	29.30%	70.40%	0.26%	0.00%	NA
Tropical Japonica	504	87.50%	12.50%	0.00%	0.00%	NA
Japonica Intermediate	241	46.50%	53.10%	0.41%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820968196	G -> A	LOC_Os08g33570.1	upstream_gene_variant ; 4921.0bp to feature; MODIFIER	silent_mutation	Average:46.51; most accessible tissue: Callus, score: 84.982	N	N	N	N
vg0820968196	G -> A	LOC_Os08g33580.1	downstream_gene_variant ; 834.0bp to feature; MODIFIER	silent_mutation	Average:46.51; most accessible tissue: Callus, score: 84.982	N	N	N	N
vg0820968196	G -> A	LOC_Os08g33580-LOC_Os08g33590	intergenic_region ; MODIFIER	silent_mutation	Average:46.51; most accessible tissue: Callus, score: 84.982	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820968196	6.41E-06	1.16E-08	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196	NA	8.07E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196	NA	3.52E-06	mr1989	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196	NA	4.97E-06	mr1027_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196	NA	3.63E-09	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196	NA	3.43E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196	NA	1.09E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196	2.60E-06	NA	mr1563_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196	NA	1.09E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251