\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820968196:

Variant ID: vg0820968196 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20968196
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATATTTGAATTCTCAAAAACAATTTGAAGTTTTACTAAAAATCTACTTTCACTCTATGTTGAAACCTCGAAGTTACTCCCTCCATACTTACAAAGGAA[G/A]
TCGTTTAGGATAATGTTTAAGTCAAACCTTGGGAATATAAATCATGAATAACTCTCAAGTTGTTGAGTTTGAAAATGTAAAACTTATATGAATATATTTG

Reverse complement sequence

CAAATATATTCATATAAGTTTTACATTTTCAAACTCAACAACTTGAGAGTTATTCATGATTTATATTCCCAAGGTTTGACTTAAACATTATCCTAAACGA[C/T]
TTCCTTTGTAAGTATGGAGGGAGTAACTTCGAGGTTTCAACATAGAGTGAAAGTAGATTTTTAGTAAAACTTCAAATTGTTTTTGAGAATTCAAATATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 17.00% 0.08% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 51.50% 48.30% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 29.30% 70.40% 0.26% 0.00% NA
Tropical Japonica  504 87.50% 12.50% 0.00% 0.00% NA
Japonica Intermediate  241 46.50% 53.10% 0.41% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820968196 G -> A LOC_Os08g33570.1 upstream_gene_variant ; 4921.0bp to feature; MODIFIER silent_mutation Average:46.51; most accessible tissue: Callus, score: 84.982 N N N N
vg0820968196 G -> A LOC_Os08g33580.1 downstream_gene_variant ; 834.0bp to feature; MODIFIER silent_mutation Average:46.51; most accessible tissue: Callus, score: 84.982 N N N N
vg0820968196 G -> A LOC_Os08g33580-LOC_Os08g33590 intergenic_region ; MODIFIER silent_mutation Average:46.51; most accessible tissue: Callus, score: 84.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820968196 6.41E-06 1.16E-08 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196 NA 8.07E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196 NA 3.52E-06 mr1989 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196 NA 4.97E-06 mr1027_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196 NA 3.63E-09 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196 NA 3.43E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196 NA 1.09E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196 2.60E-06 NA mr1563_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820968196 NA 1.09E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251