\
| Variant ID: vg0820968196 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20968196 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTATATTTGAATTCTCAAAAACAATTTGAAGTTTTACTAAAAATCTACTTTCACTCTATGTTGAAACCTCGAAGTTACTCCCTCCATACTTACAAAGGAA[G/A]
TCGTTTAGGATAATGTTTAAGTCAAACCTTGGGAATATAAATCATGAATAACTCTCAAGTTGTTGAGTTTGAAAATGTAAAACTTATATGAATATATTTG
CAAATATATTCATATAAGTTTTACATTTTCAAACTCAACAACTTGAGAGTTATTCATGATTTATATTCCCAAGGTTTGACTTAAACATTATCCTAAACGA[C/T]
TTCCTTTGTAAGTATGGAGGGAGTAACTTCGAGGTTTCAACATAGAGTGAAAGTAGATTTTTAGTAAAACTTCAAATTGTTTTTGAGAATTCAAATATAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.90% | 17.00% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 51.50% | 48.30% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 29.30% | 70.40% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 46.50% | 53.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820968196 | G -> A | LOC_Os08g33570.1 | upstream_gene_variant ; 4921.0bp to feature; MODIFIER | silent_mutation | Average:46.51; most accessible tissue: Callus, score: 84.982 | N | N | N | N |
| vg0820968196 | G -> A | LOC_Os08g33580.1 | downstream_gene_variant ; 834.0bp to feature; MODIFIER | silent_mutation | Average:46.51; most accessible tissue: Callus, score: 84.982 | N | N | N | N |
| vg0820968196 | G -> A | LOC_Os08g33580-LOC_Os08g33590 | intergenic_region ; MODIFIER | silent_mutation | Average:46.51; most accessible tissue: Callus, score: 84.982 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820968196 | 6.41E-06 | 1.16E-08 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820968196 | NA | 8.07E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820968196 | NA | 3.52E-06 | mr1989 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820968196 | NA | 4.97E-06 | mr1027_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820968196 | NA | 3.63E-09 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820968196 | NA | 3.43E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820968196 | NA | 1.09E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820968196 | 2.60E-06 | NA | mr1563_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820968196 | NA | 1.09E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |