\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820950016:

Variant ID: vg0820950016 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20950016
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTATGTCAGAAGTAAAGAAGAGAGGAGATATTCCAATAGACAATCCAATTGAGGTTGATGGCATACAAGGTGGAGATATTCCATTGGGTAATAATCA[A/G]
GTCTTAGAAGGTGGAGATGGTGCTGAATACTTTGATTCAGATGGTGATGCATCGTACGATGAGGACAGTGATGGTGTCTTTACAAGAAGGAAGTGCAGGT

Reverse complement sequence

ACCTGCACTTCCTTCTTGTAAAGACACCATCACTGTCCTCATCGTACGATGCATCACCATCTGAATCAAAGTATTCAGCACCATCTCCACCTTCTAAGAC[T/C]
TGATTATTACCCAATGGAATATCTCCACCTTGTATGCCATCAACCTCAATTGGATTGTCTATTGGAATATCTCCTCTCTTCTTTACTTCTGACATAAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.20% 1.20% 15.38% 63.14% NA
All Indica  2759 4.70% 0.10% 6.02% 89.13% NA
All Japonica  1512 48.00% 2.20% 23.28% 26.52% NA
Aus  269 21.60% 0.00% 48.33% 30.11% NA
Indica I  595 2.70% 0.00% 2.18% 95.13% NA
Indica II  465 1.70% 0.00% 4.09% 94.19% NA
Indica III  913 6.00% 0.40% 7.12% 86.42% NA
Indica Intermediate  786 6.50% 0.00% 8.78% 84.73% NA
Temperate Japonica  767 72.60% 0.70% 6.26% 20.47% NA
Tropical Japonica  504 10.10% 3.00% 48.21% 38.69% NA
Japonica Intermediate  241 49.00% 5.40% 25.31% 20.33% NA
VI/Aromatic  96 14.60% 16.70% 56.25% 12.50% NA
Intermediate  90 32.20% 5.60% 27.78% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820950016 A -> G LOC_Os08g33550.1 synonymous_variant ; p.Gln303Gln; LOW synonymous_codon Average:7.1; most accessible tissue: Zhenshan97 flower, score: 13.891 N N N N
vg0820950016 A -> DEL LOC_Os08g33550.1 N frameshift_variant Average:7.1; most accessible tissue: Zhenshan97 flower, score: 13.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820950016 NA 8.28E-17 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 3.75E-14 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 2.64E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 7.14E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 2.92E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 3.84E-17 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 6.23E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 3.65E-29 mr1401_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 1.10E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 1.48E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 1.65E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 6.14E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 7.07E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 1.23E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 1.03E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 4.05E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 1.50E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820950016 NA 1.04E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251