Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820942801:

Variant ID: vg0820942801 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20942801
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AATGTGCCCATCAACCTTAGTAAATGGAAATCCGACTTCAGAGAGGATTTTACTCGGCATATGCACAGAGTAAAAGTTGCAGACACTTGAGTAAATAATG[G/A]
CATAAAGACAATCGGCTGATGATAATGTAATAAAACAATAATATAATCCAACATAAACCAATCGGCTAATAATGGTATGATACAATAAGCATTGATCCAA

Reverse complement sequence

TTGGATCAATGCTTATTGTATCATACCATTATTAGCCGATTGGTTTATGTTGGATTATATTATTGTTTTATTACATTATCATCAGCCGATTGTCTTTATG[C/T]
CATTATTTACTCAAGTGTCTGCAACTTTTACTCTGTGCATATGCCGAGTAAAATCCTCTCTGAAGTCGGATTTCCATTTACTAAGGTTGATGGGCACATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.70%	15.20%	0.11%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	53.60%	46.10%	0.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	29.90%	69.90%	0.26%	0.00%	NA
Tropical Japonica	504	90.70%	9.30%	0.00%	0.00%	NA
Japonica Intermediate	241	51.90%	47.30%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820942801	G -> A	LOC_Os08g33540.1	downstream_gene_variant ; 2255.0bp to feature; MODIFIER	silent_mutation	Average:36.366; most accessible tissue: Callus, score: 74.852	N	N	N	N
vg0820942801	G -> A	LOC_Os08g33540.2	downstream_gene_variant ; 2255.0bp to feature; MODIFIER	silent_mutation	Average:36.366; most accessible tissue: Callus, score: 74.852	N	N	N	N
vg0820942801	G -> A	LOC_Os08g33530-LOC_Os08g33540	intergenic_region ; MODIFIER	silent_mutation	Average:36.366; most accessible tissue: Callus, score: 74.852	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820942801	NA	3.06E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	2.88E-06	NA	mr1124	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	7.85E-07	1.19E-09	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	4.41E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	5.75E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	9.44E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	1.71E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	8.95E-06	8.95E-06	mr1861	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	9.15E-06	mr1989	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	2.11E-06	NA	mr1027_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	8.27E-06	mr1027_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	1.03E-08	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	1.41E-13	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	3.96E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	1.30E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	1.71E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	1.11E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	4.61E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	2.11E-19	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820942801	NA	1.83E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251