Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0820921834:

Variant ID: vg0820921834 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20921834
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCTTTTCCATCTTCTTCCTTCTTTCTCCCGTCTTCTTCCCTAGCCTCCTCCGCCGCCAGCCGCACCCTTCCTCACCGGCGGTTGTCACCTCTCCTATTG[T/C]
CTGGGCACAGCGAGAGTGAGAGCGACGGTGGCTTGCAACGATGAGTTTCGATGGATGAATCGGCACCGGAGGAGGAGGAGGGCGCGCATCCACTCTGCAC

Reverse complement sequence

GTGCAGAGTGGATGCGCGCCCTCCTCCTCCTCCGGTGCCGATTCATCCATCGAAACTCATCGTTGCAAGCCACCGTCGCTCTCACTCTCGCTGTGCCCAG[A/G]
CAATAGGAGAGGTGACAACCGCCGGTGAGGAAGGGTGCGGCTGGCGGCGGAGGAGGCTAGGGAAGAAGACGGGAGAAAGAAGGAAGAAGATGGAAAAGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.50%	19.10%	0.34%	19.02%	NA
All Indica	2759	93.70%	3.20%	0.18%	2.94%	NA
All Japonica	1512	3.30%	50.20%	0.46%	46.03%	NA
Aus	269	79.60%	0.00%	1.12%	19.33%	NA
Indica I	595	95.30%	3.20%	0.17%	1.34%	NA
Indica II	465	99.40%	0.20%	0.22%	0.22%	NA
Indica III	913	91.30%	3.80%	0.11%	4.71%	NA
Indica Intermediate	786	92.00%	4.10%	0.25%	3.69%	NA
Temperate Japonica	767	1.30%	73.90%	0.39%	24.38%	NA
Tropical Japonica	504	6.20%	12.70%	0.60%	80.56%	NA
Japonica Intermediate	241	3.70%	53.10%	0.41%	42.74%	NA
VI/Aromatic	96	10.40%	35.40%	1.04%	53.12%	NA
Intermediate	90	51.10%	27.80%	0.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820921834	T -> C	LOC_Os08g33510.1	downstream_gene_variant ; 3402.0bp to feature; MODIFIER	silent_mutation	Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg0820921834	T -> C	LOC_Os08g33520.1	downstream_gene_variant ; 2658.0bp to feature; MODIFIER	silent_mutation	Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg0820921834	T -> C	LOC_Os08g33510-LOC_Os08g33520	intergenic_region ; MODIFIER	silent_mutation	Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg0820921834	T -> DEL	N	N	silent_mutation	Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820921834	3.12E-06	4.66E-09	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834	NA	1.94E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834	NA	9.57E-08	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834	NA	1.37E-07	mr1989	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834	NA	7.85E-08	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834	NA	3.86E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834	3.80E-07	NA	mr1563_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251