\
| Variant ID: vg0820921834 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20921834 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCTTTTCCATCTTCTTCCTTCTTTCTCCCGTCTTCTTCCCTAGCCTCCTCCGCCGCCAGCCGCACCCTTCCTCACCGGCGGTTGTCACCTCTCCTATTG[T/C]
CTGGGCACAGCGAGAGTGAGAGCGACGGTGGCTTGCAACGATGAGTTTCGATGGATGAATCGGCACCGGAGGAGGAGGAGGGCGCGCATCCACTCTGCAC
GTGCAGAGTGGATGCGCGCCCTCCTCCTCCTCCGGTGCCGATTCATCCATCGAAACTCATCGTTGCAAGCCACCGTCGCTCTCACTCTCGCTGTGCCCAG[A/G]
CAATAGGAGAGGTGACAACCGCCGGTGAGGAAGGGTGCGGCTGGCGGCGGAGGAGGCTAGGGAAGAAGACGGGAGAAAGAAGGAAGAAGATGGAAAAGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 19.10% | 0.34% | 19.02% | NA |
| All Indica | 2759 | 93.70% | 3.20% | 0.18% | 2.94% | NA |
| All Japonica | 1512 | 3.30% | 50.20% | 0.46% | 46.03% | NA |
| Aus | 269 | 79.60% | 0.00% | 1.12% | 19.33% | NA |
| Indica I | 595 | 95.30% | 3.20% | 0.17% | 1.34% | NA |
| Indica II | 465 | 99.40% | 0.20% | 0.22% | 0.22% | NA |
| Indica III | 913 | 91.30% | 3.80% | 0.11% | 4.71% | NA |
| Indica Intermediate | 786 | 92.00% | 4.10% | 0.25% | 3.69% | NA |
| Temperate Japonica | 767 | 1.30% | 73.90% | 0.39% | 24.38% | NA |
| Tropical Japonica | 504 | 6.20% | 12.70% | 0.60% | 80.56% | NA |
| Japonica Intermediate | 241 | 3.70% | 53.10% | 0.41% | 42.74% | NA |
| VI/Aromatic | 96 | 10.40% | 35.40% | 1.04% | 53.12% | NA |
| Intermediate | 90 | 51.10% | 27.80% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820921834 | T -> C | LOC_Os08g33510.1 | downstream_gene_variant ; 3402.0bp to feature; MODIFIER | silent_mutation | Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| vg0820921834 | T -> C | LOC_Os08g33520.1 | downstream_gene_variant ; 2658.0bp to feature; MODIFIER | silent_mutation | Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| vg0820921834 | T -> C | LOC_Os08g33510-LOC_Os08g33520 | intergenic_region ; MODIFIER | silent_mutation | Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| vg0820921834 | T -> DEL | N | N | silent_mutation | Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820921834 | 3.12E-06 | 4.66E-09 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820921834 | NA | 1.94E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820921834 | NA | 9.57E-08 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820921834 | NA | 1.37E-07 | mr1989 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820921834 | NA | 7.85E-08 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820921834 | NA | 3.86E-15 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820921834 | 3.80E-07 | NA | mr1563_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |