\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820921834:

Variant ID: vg0820921834 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20921834
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTTTTCCATCTTCTTCCTTCTTTCTCCCGTCTTCTTCCCTAGCCTCCTCCGCCGCCAGCCGCACCCTTCCTCACCGGCGGTTGTCACCTCTCCTATTG[T/C]
CTGGGCACAGCGAGAGTGAGAGCGACGGTGGCTTGCAACGATGAGTTTCGATGGATGAATCGGCACCGGAGGAGGAGGAGGGCGCGCATCCACTCTGCAC

Reverse complement sequence

GTGCAGAGTGGATGCGCGCCCTCCTCCTCCTCCGGTGCCGATTCATCCATCGAAACTCATCGTTGCAAGCCACCGTCGCTCTCACTCTCGCTGTGCCCAG[A/G]
CAATAGGAGAGGTGACAACCGCCGGTGAGGAAGGGTGCGGCTGGCGGCGGAGGAGGCTAGGGAAGAAGACGGGAGAAAGAAGGAAGAAGATGGAAAAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 19.10% 0.34% 19.02% NA
All Indica  2759 93.70% 3.20% 0.18% 2.94% NA
All Japonica  1512 3.30% 50.20% 0.46% 46.03% NA
Aus  269 79.60% 0.00% 1.12% 19.33% NA
Indica I  595 95.30% 3.20% 0.17% 1.34% NA
Indica II  465 99.40% 0.20% 0.22% 0.22% NA
Indica III  913 91.30% 3.80% 0.11% 4.71% NA
Indica Intermediate  786 92.00% 4.10% 0.25% 3.69% NA
Temperate Japonica  767 1.30% 73.90% 0.39% 24.38% NA
Tropical Japonica  504 6.20% 12.70% 0.60% 80.56% NA
Japonica Intermediate  241 3.70% 53.10% 0.41% 42.74% NA
VI/Aromatic  96 10.40% 35.40% 1.04% 53.12% NA
Intermediate  90 51.10% 27.80% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820921834 T -> C LOC_Os08g33510.1 downstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0820921834 T -> C LOC_Os08g33520.1 downstream_gene_variant ; 2658.0bp to feature; MODIFIER silent_mutation Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0820921834 T -> C LOC_Os08g33510-LOC_Os08g33520 intergenic_region ; MODIFIER silent_mutation Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0820921834 T -> DEL N N silent_mutation Average:60.458; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820921834 3.12E-06 4.66E-09 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834 NA 1.94E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834 NA 9.57E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834 NA 1.37E-07 mr1989 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834 NA 7.85E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834 NA 3.86E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820921834 3.80E-07 NA mr1563_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251