\
| Variant ID: vg0820892173 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20892173 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACAAGTTGTCTCGAGGAGGAGGAGGAGAGGAGAGGAGATTGAGATAACTTGGAAGTGATTTATTAACGTGAATATAATTTACTCTTTTATTCCAGTGATC[G/A]
AGGCTATGCTTTCATAACTTATCTTCTCATTTTTTACGTGCATGCTTTCCAAACTACTGAACGACGTGTTTTTGCAAAAGTTTTTTAATACGAAAGTTGC
GCAACTTTCGTATTAAAAAACTTTTGCAAAAACACGTCGTTCAGTAGTTTGGAAAGCATGCACGTAAAAAATGAGAAGATAAGTTATGAAAGCATAGCCT[C/T]
GATCACTGGAATAAAAGAGTAAATTATATTCACGTTAATAAATCACTTCCAAGTTATCTCAATCTCCTCTCCTCTCCTCCTCCTCCTCGAGACAACTTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.20% | 46.60% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 88.90% | 10.90% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 1.10% | 98.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 5.90% | 94.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 84.90% | 14.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 84.40% | 15.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 64.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820892173 | G -> A | LOC_Os08g33479-LOC_Os08g33488 | intergenic_region ; MODIFIER | silent_mutation | Average:63.91; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820892173 | NA | 1.64E-33 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 7.43E-50 | mr1063 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.00E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.12E-34 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.27E-14 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 5.34E-29 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.08E-30 | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 4.84E-44 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.03E-24 | mr1551 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 4.19E-18 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.06E-24 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 9.41E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.51E-29 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.51E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 8.36E-15 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.53E-06 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 9.51E-06 | mr1046_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.22E-54 | mr1063_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.76E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.63E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.20E-14 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.79E-36 | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 5.96E-22 | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | 6.68E-06 | 6.68E-06 | mr1166_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.44E-20 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.55E-10 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.41E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.28E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.19E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.66E-10 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.15E-35 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.01E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 8.53E-06 | mr1230_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.74E-17 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.58E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | 1.76E-06 | 3.05E-08 | mr1283_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.54E-06 | mr1288_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.97E-08 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 7.58E-06 | mr1318_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.70E-06 | mr1345_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | 4.29E-06 | 4.29E-06 | mr1372_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.75E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.18E-06 | mr1388_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | 2.45E-06 | 5.57E-26 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.64E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.61E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | 7.33E-06 | 7.03E-07 | mr1409_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 4.76E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.66E-25 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 8.77E-09 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.06E-06 | mr1432_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.57E-06 | mr1447_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.24E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.38E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.74E-43 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | 5.79E-06 | 5.79E-06 | mr1512_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.32E-14 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 7.92E-07 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 8.01E-59 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.05E-37 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | 5.47E-06 | 5.47E-06 | mr1573_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.04E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.01E-32 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 9.12E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.17E-06 | mr1649_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 8.81E-06 | mr1740_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 7.26E-10 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.44E-11 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.25E-06 | mr1784_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.36E-06 | mr1785_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.15E-48 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | 5.56E-06 | NA | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | 2.77E-06 | 5.24E-08 | mr1800_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.27E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 1.53E-32 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.39E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.04E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 6.81E-17 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.97E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 3.23E-22 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.79E-22 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 2.17E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820892173 | NA | 5.22E-29 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |