\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820887467:

Variant ID: vg0820887467 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20887467
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATTCGAATGTACAAACGAACTAAGGGTGCGTTCGTTGGATTGGGTGAGAAAGCCCCATCGTATTCCGCGCGCACGCTTCCCAAACTATTAAACGGTG[T/C]
ATTTTTTATAAAAATTTTCTATAAGAAAGTTGCTTTAAAAAATTATATTAATCTATTTTTAAAATTTAAAATAGTTAATACTCAATTAATCATGCGCTAA

Reverse complement sequence

TTAGCGCATGATTAATTGAGTATTAACTATTTTAAATTTTAAAAATAGATTAATATAATTTTTTAAAGCAACTTTCTTATAGAAAATTTTTATAAAAAAT[A/G]
CACCGTTTAATAGTTTGGGAAGCGTGCGCGCGGAATACGATGGGGCTTTCTCACCCAATCCAACGAACGCACCCTTAGTTCGTTTGTACATTCGAATTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 20.70% 0.06% 0.00% NA
All Indica  2759 94.20% 5.80% 0.07% 0.00% NA
All Japonica  1512 49.90% 50.10% 0.00% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 90.90% 9.10% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 6.70% 0.25% 0.00% NA
Temperate Japonica  767 25.90% 74.10% 0.00% 0.00% NA
Tropical Japonica  504 87.50% 12.50% 0.00% 0.00% NA
Japonica Intermediate  241 47.30% 52.70% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820887467 T -> C LOC_Os08g33479.1 downstream_gene_variant ; 1224.0bp to feature; MODIFIER silent_mutation Average:65.576; most accessible tissue: Minghui63 root, score: 91.258 N N N N
vg0820887467 T -> C LOC_Os08g33479.2 downstream_gene_variant ; 1224.0bp to feature; MODIFIER silent_mutation Average:65.576; most accessible tissue: Minghui63 root, score: 91.258 N N N N
vg0820887467 T -> C LOC_Os08g33479-LOC_Os08g33488 intergenic_region ; MODIFIER silent_mutation Average:65.576; most accessible tissue: Minghui63 root, score: 91.258 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820887467 4.23E-06 7.77E-09 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 4.08E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 3.17E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 2.94E-06 1.41E-08 mr1989 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 1.25E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 2.12E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 5.21E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 1.01E-13 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 5.63E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 4.88E-06 NA mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 2.41E-06 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 3.22E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 3.45E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 6.55E-06 NA mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 3.61E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 2.16E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820887467 NA 7.75E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251