\
| Variant ID: vg0820873126 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20873126 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.34, others allele: 0.00, population size: 97. )
GATCTATGAATATTACCTGAAATCGGCGTCTGAATCCGGTAGGGCTTCGCCCCTTCTTCTCTTCTCCTCCCCTTTCTTCTTTTTTTTCACTGGATTTGAG[A/G]
GGGGAGGAATGAGGGCTGGGAGCTGGGCGGCAGGCCTTTTATAGGCAGCGAGGCCTGCCGCCCGGCCAGAGGGCGGCAAGGGGCCGCCTGCAAAATGCCG
CGGCATTTTGCAGGCGGCCCCTTGCCGCCCTCTGGCCGGGCGGCAGGCCTCGCTGCCTATAAAAGGCCTGCCGCCCAGCTCCCAGCCCTCATTCCTCCCC[T/C]
CTCAAATCCAGTGAAAAAAAAGAAGAAAGGGGAGGAGAAGAGAAGAAGGGGCGAAGCCCTACCGGATTCAGACGCCGATTTCAGGTAATATTCATAGATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 1.40% | 10.98% | 48.96% | NA |
| All Indica | 2759 | 4.90% | 2.10% | 12.29% | 80.75% | NA |
| All Japonica | 1512 | 98.70% | 0.10% | 0.13% | 1.12% | NA |
| Aus | 269 | 19.70% | 2.60% | 62.45% | 15.24% | NA |
| Indica I | 595 | 3.00% | 1.20% | 3.87% | 91.93% | NA |
| Indica II | 465 | 1.70% | 3.00% | 7.31% | 87.96% | NA |
| Indica III | 913 | 6.20% | 2.40% | 19.17% | 72.18% | NA |
| Indica Intermediate | 786 | 6.50% | 1.90% | 13.61% | 77.99% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 97.80% | 0.20% | 0.20% | 1.79% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 60.00% | 1.10% | 10.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820873126 | A -> G | LOC_Os08g33450.1 | upstream_gene_variant ; 855.0bp to feature; MODIFIER | silent_mutation | Average:25.34; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0820873126 | A -> G | LOC_Os08g33460.1 | upstream_gene_variant ; 426.0bp to feature; MODIFIER | silent_mutation | Average:25.34; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0820873126 | A -> G | LOC_Os08g33450-LOC_Os08g33460 | intergenic_region ; MODIFIER | silent_mutation | Average:25.34; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0820873126 | A -> DEL | N | N | silent_mutation | Average:25.34; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820873126 | NA | 6.09E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 3.21E-15 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 2.84E-13 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 7.47E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 3.76E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 3.87E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 1.26E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 2.86E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 7.67E-06 | 7.67E-06 | mr1412_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 3.18E-08 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 1.88E-06 | 1.88E-06 | mr1418_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 7.04E-06 | mr1419_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 1.31E-06 | 1.31E-06 | mr1419_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 9.71E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 6.29E-06 | 3.90E-06 | mr1420_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 1.27E-07 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 6.59E-06 | 6.59E-06 | mr1440_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 2.01E-06 | 1.37E-06 | mr1467_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 7.77E-08 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 1.78E-06 | 1.78E-06 | mr1488_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 1.16E-11 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 5.44E-07 | 4.89E-07 | mr1556_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 3.06E-57 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 1.66E-33 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 4.24E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 3.61E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 1.75E-15 | mr1744_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 1.50E-06 | 1.50E-06 | mr1747_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 7.21E-06 | 6.67E-06 | mr1759_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 5.81E-07 | 5.81E-07 | mr1764_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 8.52E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 4.44E-07 | 2.69E-07 | mr1823_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 5.60E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 2.36E-06 | 1.07E-06 | mr1824_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 5.80E-07 | 3.45E-07 | mr1831_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 1.80E-06 | 1.80E-06 | mr1840_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | 3.76E-06 | 2.66E-06 | mr1856_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 2.68E-20 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 9.94E-25 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820873126 | NA | 6.35E-07 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |