Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820868579:

Variant ID: vg0820868579 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20868579
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACGATCGATGTGATGTACAATGAACTTAGCAATTAACTTAACAATACGAGAAGATCGATGTGACGTACCTGACGACGGCACCACAGAGTACCCATCATA[T/G]
GGTAGTCGACCTCTGGTCGCTCCGCGTACAGTGACTCCTCGTACGCGTGCTGGTCCACCTCAGGGCGGCCGATCGCAATCCTCTCAGCTGCCCAGATAGA

Reverse complement sequence

TCTATCTGGGCAGCTGAGAGGATTGCGATCGGCCGCCCTGAGGTGGACCAGCACGCGTACGAGGAGTCACTGTACGCGGAGCGACCAGAGGTCGACTACC[A/C]
TATGATGGGTACTCTGTGGTGCCGTCGTCAGGTACGTCACATCGATCTTCTCGTATTGTTAAGTTAATTGCTAAGTTCATTGTACATCACATCGATCGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.00%	11.90%	2.16%	0.00%	NA
All Indica	2759	99.60%	0.10%	0.25%	0.00%	NA
All Japonica	1512	57.70%	36.10%	6.15%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.40%	0.20%	0.43%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.40%	0.30%	0.38%	0.00%	NA
Temperate Japonica	767	30.10%	60.00%	9.91%	0.00%	NA
Tropical Japonica	504	93.10%	6.90%	0.00%	0.00%	NA
Japonica Intermediate	241	71.80%	21.20%	7.05%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820868579	T -> G	LOC_Os08g33450.1	missense_variant ; p.His468Pro; MODERATE	nonsynonymous_codon ; H468P	Average:43.067; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	probably damaging	-2.825	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820868579	NA	7.69E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	5.21E-07	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	2.07E-06	NA	mr1080	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	4.99E-08	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	6.00E-06	9.75E-30	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	8.41E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	7.46E-06	mr1157	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	2.11E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	2.99E-06	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	8.75E-06	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	2.30E-06	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	6.53E-07	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	2.03E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	4.61E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	9.38E-08	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	5.33E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	7.66E-08	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	8.34E-07	mr1989	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	5.65E-08	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	7.66E-14	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	6.52E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	4.75E-08	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	1.85E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	6.68E-12	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	1.58E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820868579	NA	3.93E-11	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251