\
| Variant ID: vg0820868286 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20868286 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.21, others allele: 0.00, population size: 86. )
GACGGTCGTCGGAAACAGTACTGGAAAGGGCTGACGGAAGCCGAACTGCTGCATCACGCGGAAAGGGGCGTGAGGCTCAACGCAGATGTCGAAGACCATC[A/G]
GAACCGTAGTCATCCAGTATGCCTGGTCCCTAGTGCAGAGTGTGGACAGACCCAACGGCGCACGAGCCTGGGTAGCCGCGGCACTGTAGGGCTCCCACAC
GTGTGGGAGCCCTACAGTGCCGCGGCTACCCAGGCTCGTGCGCCGTTGGGTCTGTCCACACTCTGCACTAGGGACCAGGCATACTGGATGACTACGGTTC[T/C]
GATGGTCTTCGACATCTGCGTTGAGCCTCACGCCCCTTTCCGCGTGATGCAGCAGTTCGGCTTCCGTCAGCCCTTTCCAGTACTGTTTCCGACGACCGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.90% | 38.80% | 3.26% | 0.02% | NA |
| All Indica | 2759 | 91.90% | 5.00% | 3.01% | 0.04% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 55.80% | 20.10% | 24.16% | 0.00% | NA |
| Indica I | 595 | 94.10% | 2.50% | 3.36% | 0.00% | NA |
| Indica II | 465 | 97.00% | 1.30% | 1.72% | 0.00% | NA |
| Indica III | 913 | 90.70% | 6.70% | 2.63% | 0.00% | NA |
| Indica Intermediate | 786 | 88.70% | 7.30% | 3.94% | 0.13% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 97.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 97.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 62.20% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820868286 | A -> G | LOC_Os08g33450.1 | missense_variant ; p.Leu539Pro; MODERATE | nonsynonymous_codon ; L539P | Average:19.209; most accessible tissue: Minghui63 root, score: 25.504 | possibly damaging |
-1.866 |
TOLERATED | 1.00 |
| vg0820868286 | A -> DEL | LOC_Os08g33450.1 | N | frameshift_variant | Average:19.209; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820868286 | NA | 3.35E-26 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820868286 | NA | 7.77E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820868286 | NA | 2.74E-29 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820868286 | NA | 2.92E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820868286 | 2.24E-06 | NA | mr1654 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820868286 | NA | 2.59E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820868286 | NA | 1.96E-28 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820868286 | NA | 2.49E-12 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820868286 | NA | 2.11E-32 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |