\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820847989:

Variant ID: vg0820847989 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20847989
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAGCCCCACTCCGCAAAACACACCTCTCCTCTCCTTCCCTCATATTTTAACCATTCCACCCCTCACAAATCTCACTATTTACTTACCTTTACTCCGCC[G/T]
AATAAAACCAACCAACCCACCCTCCTCCTCCCTCGCCCGCCTCTTATTTTTTCTTTTCTCTCCCCCAAATCTGATCCCCTCCCACACGCAACACGCGAGG

Reverse complement sequence

CCTCGCGTGTTGCGTGTGGGAGGGGATCAGATTTGGGGGAGAGAAAAGAAAAAATAAGAGGCGGGCGAGGGAGGAGGAGGGTGGGTTGGTTGGTTTTATT[C/A]
GGCGGAGTAAAGGTAAGTAAATAGTGAGATTTGTGAGGGGTGGAATGGTTAAAATATGAGGGAAGGAGAGGAGAGGTGTGTTTTGCGGAGTGGGGCTTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 9.80% 0.68% 0.42% NA
All Indica  2759 83.30% 16.50% 0.18% 0.00% NA
All Japonica  1512 97.10% 0.20% 1.52% 1.19% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 87.30% 12.50% 0.22% 0.00% NA
Indica III  913 70.00% 29.60% 0.44% 0.00% NA
Indica Intermediate  786 85.90% 14.10% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 0.10% 0.91% 0.39% NA
Tropical Japonica  504 95.00% 0.20% 2.38% 2.38% NA
Japonica Intermediate  241 96.70% 0.40% 1.66% 1.24% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 90.00% 5.60% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820847989 G -> T LOC_Os08g33410.1 upstream_gene_variant ; 4832.0bp to feature; MODIFIER silent_mutation Average:99.533; most accessible tissue: Zhenshan97 young leaf, score: 99.732 N N N N
vg0820847989 G -> T LOC_Os08g33420.1 upstream_gene_variant ; 35.0bp to feature; MODIFIER silent_mutation Average:99.533; most accessible tissue: Zhenshan97 young leaf, score: 99.732 N N N N
vg0820847989 G -> T LOC_Os08g33410-LOC_Os08g33420 intergenic_region ; MODIFIER silent_mutation Average:99.533; most accessible tissue: Zhenshan97 young leaf, score: 99.732 N N N N
vg0820847989 G -> DEL N N silent_mutation Average:99.533; most accessible tissue: Zhenshan97 young leaf, score: 99.732 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820847989 G T -0.02 -0.03 -0.06 0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820847989 NA 1.28E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820847989 NA 1.24E-09 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820847989 9.91E-06 2.41E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820847989 NA 5.45E-07 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820847989 NA 4.48E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820847989 1.75E-06 5.05E-07 mr1423_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820847989 NA 6.80E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820847989 NA 7.37E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251