\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820834591:

Variant ID: vg0820834591 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20834591
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGCTAGTTTCGAAATGTTTGATTTTTTCTTATTTAAAAAATTTAGGTAATTATTAATTATTTTCATATCATTTGATTTATTGTTAAATATATTTTTAT[G/A]
TAGGCATACAATTTTACATATTTCATAAAAGTTTTTGAATAAGACGAACGGTTAAACATGTGCTAAAAAGTCAACGGTGTCGAACATTTCGAAACGGAGG

Reverse complement sequence

CCTCCGTTTCGAAATGTTCGACACCGTTGACTTTTTAGCACATGTTTAACCGTTCGTCTTATTCAAAAACTTTTATGAAATATGTAAAATTGTATGCCTA[C/T]
ATAAAAATATATTTAACAATAAATCAAATGATATGAAAATAATTAATAATTACCTAAATTTTTTAAATAAGAAAAAATCAAACATTTCGAAACTAGCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 25.00% 2.29% 0.00% NA
All Indica  2759 85.00% 11.40% 3.66% 0.00% NA
All Japonica  1512 51.30% 48.40% 0.26% 0.00% NA
Aus  269 80.70% 19.30% 0.00% 0.00% NA
Indica I  595 90.60% 1.70% 7.73% 0.00% NA
Indica II  465 95.70% 1.70% 2.58% 0.00% NA
Indica III  913 74.60% 23.90% 1.53% 0.00% NA
Indica Intermediate  786 86.40% 9.90% 3.69% 0.00% NA
Temperate Japonica  767 74.40% 25.20% 0.39% 0.00% NA
Tropical Japonica  504 14.90% 85.10% 0.00% 0.00% NA
Japonica Intermediate  241 53.90% 45.60% 0.41% 0.00% NA
VI/Aromatic  96 38.50% 61.50% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820834591 G -> A LOC_Os08g33400.1 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flower, score: 99.864 N N N N
vg0820834591 G -> A LOC_Os08g33400.2 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flower, score: 99.864 N N N N
vg0820834591 G -> A LOC_Os08g33400-LOC_Os08g33410 intergenic_region ; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flower, score: 99.864 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820834591 G A 0.0 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820834591 NA 3.25E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 7.23E-06 NA mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 1.05E-07 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 8.08E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 7.16E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 7.41E-07 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 7.36E-06 mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 6.38E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 9.02E-06 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 1.69E-06 NA mr1748 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 9.72E-06 9.72E-06 mr1748 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 1.80E-07 3.09E-06 mr1936 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 6.13E-06 mr1989 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 8.88E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 5.40E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820834591 NA 2.17E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251