\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820812927:

Variant ID: vg0820812927 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20812927
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCATCATGGTGACAGCAGCATGAGGCATCTAAATCGATGGTCTCCAATAACATGCGGAGCCATCGATCGATCGATCTTCCCATTTTACTGGCCCTCGC[A/C]
GGCGTCGCCCTTGGAGGCTTCTTTCACCTCATCACCACCGTCCTCCTGCCACAGATAGTTTCACAAGGTAAAATTAGCAAGTTGCTCATTAGGTCGATGG

Reverse complement sequence

CCATCGACCTAATGAGCAACTTGCTAATTTTACCTTGTGAAACTATCTGTGGCAGGAGGACGGTGGTGATGAGGTGAAAGAAGCCTCCAAGGGCGACGCC[T/G]
GCGAGGGCCAGTAAAATGGGAAGATCGATCGATCGATGGCTCCGCATGTTATTGGAGACCATCGATTTAGATGCCTCATGCTGCTGTCACCATGATGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 18.00% 0.04% 0.00% NA
All Indica  2759 97.90% 2.00% 0.07% 0.00% NA
All Japonica  1512 51.90% 48.10% 0.00% 0.00% NA
Aus  269 81.80% 18.20% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 96.60% 3.30% 0.11% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 26.60% 73.40% 0.00% 0.00% NA
Tropical Japonica  504 91.10% 8.90% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820812927 A -> C LOC_Os08g33370.1 missense_variant ; p.Cys253Gly; MODERATE nonsynonymous_codon ; C253G Average:92.544; most accessible tissue: Minghui63 flag leaf, score: 95.751 unknown unknown TOLERATED 0.59
vg0820812927 A -> C LOC_Os08g33370.2 missense_variant ; p.Cys253Gly; MODERATE nonsynonymous_codon ; C253G Average:92.544; most accessible tissue: Minghui63 flag leaf, score: 95.751 unknown unknown TOLERATED 0.59

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820812927 A C 0.11 0.1 0.07 0.07 0.07 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820812927 NA 9.39E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 9.71E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 2.79E-07 3.26E-10 mr1124 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 3.06E-09 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 6.24E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 6.02E-11 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 3.65E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 1.24E-11 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 6.11E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 1.72E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 7.93E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 8.16E-06 8.15E-06 mr1861 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 4.61E-10 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 1.69E-07 mr1989 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 2.11E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820812927 NA 2.63E-08 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251