\
| Variant ID: vg0820796179 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20796179 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATGGCTCGGAAGTAGAGGAAATCTGGAATTTCGATGGGTTTTATCAAAATTCAAATTTGAATTGATAAAAAAGAAAAAAAACAAATAAAATCCTATAAA[C/T]
AGTATGATATTCATATAGTCTATTTGAGTATAAATTTTCCAGAAATTTGGTGTATTCCATGTATTTCTTGAACTTTATAGTAGGAAAGAAAAGAATAACG
CGTTATTCTTTTCTTTCCTACTATAAAGTTCAAGAAATACATGGAATACACCAAATTTCTGGAAAATTTATACTCAAATAGACTATATGAATATCATACT[G/A]
TTTATAGGATTTTATTTGTTTTTTTTCTTTTTTATCAATTCAAATTTGAATTTTGATAAAACCCATCGAAATTCCAGATTTCCTCTACTTCCGAGCCATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.80% | 18.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 51.60% | 48.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.30% | 19.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 26.60% | 73.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.40% | 50.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820796179 | C -> T | LOC_Os08g33340.1 | upstream_gene_variant ; 787.0bp to feature; MODIFIER | silent_mutation | Average:61.273; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| vg0820796179 | C -> T | LOC_Os08g33340.2 | upstream_gene_variant ; 787.0bp to feature; MODIFIER | silent_mutation | Average:61.273; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| vg0820796179 | C -> T | LOC_Os08g33330.1 | downstream_gene_variant ; 1363.0bp to feature; MODIFIER | silent_mutation | Average:61.273; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| vg0820796179 | C -> T | LOC_Os08g33330-LOC_Os08g33340 | intergenic_region ; MODIFIER | silent_mutation | Average:61.273; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820796179 | NA | 8.65E-06 | mr1072 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | 2.92E-07 | 3.47E-10 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 1.63E-09 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 1.55E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 1.79E-11 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 3.61E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 7.63E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 8.56E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 1.00E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 1.31E-12 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 1.15E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | 8.80E-06 | 8.79E-06 | mr1861 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | 1.43E-06 | 1.14E-10 | mr1989 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | 9.89E-06 | 6.92E-08 | mr1989 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 1.22E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820796179 | NA | 3.34E-08 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |