\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820796179:

Variant ID: vg0820796179 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20796179
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGGCTCGGAAGTAGAGGAAATCTGGAATTTCGATGGGTTTTATCAAAATTCAAATTTGAATTGATAAAAAAGAAAAAAAACAAATAAAATCCTATAAA[C/T]
AGTATGATATTCATATAGTCTATTTGAGTATAAATTTTCCAGAAATTTGGTGTATTCCATGTATTTCTTGAACTTTATAGTAGGAAAGAAAAGAATAACG

Reverse complement sequence

CGTTATTCTTTTCTTTCCTACTATAAAGTTCAAGAAATACATGGAATACACCAAATTTCTGGAAAATTTATACTCAAATAGACTATATGAATATCATACT[G/A]
TTTATAGGATTTTATTTGTTTTTTTTCTTTTTTATCAATTCAAATTTGAATTTTGATAAAACCCATCGAAATTCCAGATTTCCTCTACTTCCGAGCCATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 18.20% 0.02% 0.00% NA
All Indica  2759 97.90% 2.10% 0.00% 0.00% NA
All Japonica  1512 51.60% 48.40% 0.00% 0.00% NA
Aus  269 80.30% 19.30% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.30% 0.00% 0.00% NA
Temperate Japonica  767 26.60% 73.40% 0.00% 0.00% NA
Tropical Japonica  504 90.70% 9.30% 0.00% 0.00% NA
Japonica Intermediate  241 49.40% 50.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820796179 C -> T LOC_Os08g33340.1 upstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:61.273; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N
vg0820796179 C -> T LOC_Os08g33340.2 upstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:61.273; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N
vg0820796179 C -> T LOC_Os08g33330.1 downstream_gene_variant ; 1363.0bp to feature; MODIFIER silent_mutation Average:61.273; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N
vg0820796179 C -> T LOC_Os08g33330-LOC_Os08g33340 intergenic_region ; MODIFIER silent_mutation Average:61.273; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820796179 NA 8.65E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 2.92E-07 3.47E-10 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 1.63E-09 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 1.55E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 1.79E-11 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 3.61E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 7.63E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 8.56E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 1.00E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 1.31E-12 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 1.15E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 8.80E-06 8.79E-06 mr1861 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 1.43E-06 1.14E-10 mr1989 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 9.89E-06 6.92E-08 mr1989 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 1.22E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820796179 NA 3.34E-08 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251