\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820742977:

Variant ID: vg0820742977 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 20742977
Reference Allele: TAlternative Allele: C,TCCCGGAGTCGCCGACGAAATCTCC,TCCTGGAGTCGCCGACGAAATCTCC,TTCCCGGAGTCGCCGACGAAATCTCC,TCCCGGTGTCGCCGACGAAATCTCC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAAGATGGAGAAGCCCACACCGCAAACTCCAGTGGAATCACCGCCGCGACGTAGCCTGCATGAATCCACACCGCGGCGTAGCTTACGCCGCGTCGTCGC[T/C,TCCCGGAGTCGCCGACGAAATCTCC,TCCTGGAGTCGCCGACGAAATCTCC,TTCCCGGAGTCGCCGACGAAATCTCC,TCCCGGTGTCGCCGACGAAATCTCC]
TCCCGGAGTCGCCGACGAAATCTCCGCCGAAATCGCCGGACGAGACGACGAGGAAAAAGGCAAAAAGCAAAATGAATCTCTCACTCTCTCTCTCTAGTCT

Reverse complement sequence

AGACTAGAGAGAGAGAGTGAGAGATTCATTTTGCTTTTTGCCTTTTTCCTCGTCGTCTCGTCCGGCGATTTCGGCGGAGATTTCGTCGGCGACTCCGGGA[A/G,GGAGATTTCGTCGGCGACTCCGGGA,GGAGATTTCGTCGGCGACTCCAGGA,GGAGATTTCGTCGGCGACTCCGGGAA,GGAGATTTCGTCGGCGACACCGGGA]
GCGACGACGCGGCGTAAGCTACGCCGCGGTGTGGATTCATGCAGGCTACGTCGCGGCGGTGATTCCACTGGAGTTTGCGGTGTGGGCTTCTCCATCTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 33.90% 2.01% 0.00% TCCCGGAGTCGCCGACGAAATCTCC: 1.08%
All Indica  2759 91.00% 4.30% 3.08% 0.00% TCCCGGAGTCGCCGACGAAATCTCC: 1.67%
All Japonica  1512 8.60% 91.10% 0.33% 0.00% NA
Aus  269 94.10% 3.30% 1.12% 0.00% TCCCGGAGTCGCCGACGAAATCTCC: 1.49%
Indica I  595 91.90% 2.50% 4.03% 0.00% TCCCGGAGTCGCCGACGAAATCTCC: 1.51%
Indica II  465 89.50% 4.10% 3.87% 0.00% TCCCGGAGTCGCCGACGAAATCTCC: 2.58%
Indica III  913 92.00% 3.60% 2.08% 0.00% TCCCGGAGTCGCCGACGAAATCTCC: 2.30%
Indica Intermediate  786 89.90% 6.50% 3.05% 0.00% TCCCGGAGTCGCCGACGAAATCTCC: 0.51%
Temperate Japonica  767 11.20% 88.40% 0.39% 0.00% NA
Tropical Japonica  504 4.40% 95.20% 0.40% 0.00% NA
Japonica Intermediate  241 9.10% 90.90% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 48.90% 47.80% 2.22% 0.00% TCCCGGAGTCGCCGACGAAATCTCC: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820742977 T -> C LOC_Os08g33280.1 upstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> C LOC_Os08g33290.1 upstream_gene_variant ; 461.0bp to feature; MODIFIER silent_mutation Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> C LOC_Os08g33280-LOC_Os08g33290 intergenic_region ; MODIFIER silent_mutation Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TCCCGGAGTCGCCGACGAAATCTCC LOC_Os08g33280.1 upstream_gene_variant ; 1748.0bp to feature; MODIFIER silent_mutation Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TCCCGGAGTCGCCGACGAAATCTCC LOC_Os08g33290.1 upstream_gene_variant ; 460.0bp to feature; MODIFIER silent_mutation Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TCCCGGAGTCGCCGACGAAATCTCC LOC_Os08g33280-LOC_Os08g33290 intergenic_region ; MODIFIER silent_mutation Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TCCTGGAGTCGCCGACGAAATCTCC LOC_Os08g33280.1 upstream_gene_variant ; 1748.0bp to feature; MODIFIER N Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TCCTGGAGTCGCCGACGAAATCTCC LOC_Os08g33290.1 upstream_gene_variant ; 460.0bp to feature; MODIFIER N Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TCCTGGAGTCGCCGACGAAATCTCC LOC_Os08g33280-LOC_Os08g33290 intergenic_region ; MODIFIER N Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TCCCGGTGTCGCCGACGAAATCTCC LOC_Os08g33280.1 upstream_gene_variant ; 1748.0bp to feature; MODIFIER N Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TCCCGGTGTCGCCGACGAAATCTCC LOC_Os08g33290.1 upstream_gene_variant ; 460.0bp to feature; MODIFIER N Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TCCCGGTGTCGCCGACGAAATCTCC LOC_Os08g33280-LOC_Os08g33290 intergenic_region ; MODIFIER N Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TTCCCGGAGTCGCCGACGAAATCTCC LOC_Os08g33280.1 upstream_gene_variant ; 1748.0bp to feature; MODIFIER N Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TTCCCGGAGTCGCCGACGAAATCTCC LOC_Os08g33290.1 upstream_gene_variant ; 460.0bp to feature; MODIFIER N Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N
vg0820742977 T -> TTCCCGGAGTCGCCGACGAAATCTCC LOC_Os08g33280-LOC_Os08g33290 intergenic_region ; MODIFIER N Average:30.567; most accessible tissue: Callus, score: 46.683 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820742977 NA 3.01E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.66E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.02E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.64E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.77E-23 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.06E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.85E-25 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 4.60E-50 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.19E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 6.17E-06 8.83E-21 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 5.74E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.71E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 7.98E-18 mr1276 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.37E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.29E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 8.22E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.14E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.68E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.17E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.35E-28 mr1383 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 4.70E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.40E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 5.35E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 6.76E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 9.74E-20 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.29E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 4.17E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 3.50E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.02E-08 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.08E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.72E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.10E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 7.29E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.34E-60 mr1695 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 4.96E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.44E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 4.87E-11 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.10E-20 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 3.74E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 7.18E-26 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 2.36E-06 NA mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 4.00E-22 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 5.95E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 5.32E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.60E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.85E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 3.71E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.41E-17 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.59E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.30E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.60E-17 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.25E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 8.48E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 4.48E-52 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 4.25E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 3.43E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.39E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.87E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 5.29E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 5.97E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 3.89E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 3.32E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.15E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.85E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 5.33E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 8.28E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 3.72E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.28E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.69E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 3.61E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 3.08E-15 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.20E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.73E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.59E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 5.59E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 8.34E-13 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 2.52E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 9.89E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 9.39E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 7.94E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 8.92E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.84E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820742977 NA 1.03E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251