\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820695601:

Variant ID: vg0820695601 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20695601
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAATTGAAAAGATAAATTCTTCAAAAAGACAAGAATGCCCCTAGGGTCAAAAGCTTTTGAGCTGAAACTAGAGTGAAGATGGAATATAATGTATGCTA[A/G]
TGATGTACTTAGGGTGATGGCAAATTTAGAGTTACATAATTTCTAAATTTTACTTTAACGTCATATTTGAGCATGTGGTCTTAGAGCATTCTCGTCTTTA

Reverse complement sequence

TAAAGACGAGAATGCTCTAAGACCACATGCTCAAATATGACGTTAAAGTAAAATTTAGAAATTATGTAACTCTAAATTTGCCATCACCCTAAGTACATCA[T/C]
TAGCATACATTATATTCCATCTTCACTCTAGTTTCAGCTCAAAAGCTTTTGACCCTAGGGGCATTCTTGTCTTTTTGAAGAATTTATCTTTTCAATTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 42.30% 0.72% 0.63% NA
All Indica  2759 87.80% 10.70% 0.76% 0.80% NA
All Japonica  1512 1.90% 97.90% 0.07% 0.07% NA
Aus  269 64.70% 29.70% 2.97% 2.60% NA
Indica I  595 96.50% 2.50% 0.50% 0.50% NA
Indica II  465 91.60% 3.70% 3.44% 1.29% NA
Indica III  913 83.00% 16.60% 0.00% 0.33% NA
Indica Intermediate  786 84.50% 14.00% 0.25% 1.27% NA
Temperate Japonica  767 2.00% 97.90% 0.00% 0.13% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 36.70% 58.90% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820695601 A -> G LOC_Os08g33210.1 downstream_gene_variant ; 2818.0bp to feature; MODIFIER silent_mutation Average:36.337; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0820695601 A -> G LOC_Os08g33200-LOC_Os08g33210 intergenic_region ; MODIFIER silent_mutation Average:36.337; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0820695601 A -> DEL N N silent_mutation Average:36.337; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820695601 NA 6.51E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 1.88E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 1.45E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 2.18E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 1.26E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 7.78E-06 mr1327 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 8.34E-06 3.34E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 4.01E-25 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 2.10E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 2.10E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 4.11E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 2.69E-06 9.97E-07 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 4.98E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 1.21E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 6.83E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 7.24E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 4.46E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 1.15E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 8.82E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820695601 NA 1.17E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251