Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0820681231:

Variant ID: vg0820681231 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20681231
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.17, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

CTAATTCATTTGTAAGAGTGCTCTAGCCAGATCCGCTCTAGTCAGAGCTGAAACTATTTAGTTGCGCTCAAGCTCTAAAAGAGATAGAGTTAGAGAGCCC[T/C]
GTACCAAACAAACTCTTATCACAGCTTAGTACTCCAGTACAGTAGTACCAAGTTGACTCTGCATATTTGTCCGACTTACGCCGTGTTTAGTTCCAAAATA

Reverse complement sequence

TATTTTGGAACTAAACACGGCGTAAGTCGGACAAATATGCAGAGTCAACTTGGTACTACTGTACTGGAGTACTAAGCTGTGATAAGAGTTTGTTTGGTAC[A/G]
GGGCTCTCTAACTCTATCTCTTTTAGAGCTTGAGCGCAACTAAATAGTTTCAGCTCTGACTAGAGCGGATCTGGCTAGAGCACTCTTACAAATGAATTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	47.60%	0.74%	2.03%	NA
All Indica	2759	21.80%	73.70%	1.05%	3.44%	NA
All Japonica	1512	98.90%	0.90%	0.26%	0.00%	NA
Aus	269	34.20%	65.40%	0.37%	0.00%	NA
Indica I	595	17.80%	78.50%	1.18%	2.52%	NA
Indica II	465	17.00%	77.80%	1.08%	4.09%	NA
Indica III	913	26.10%	69.80%	0.88%	3.29%	NA
Indica Intermediate	786	22.80%	72.10%	1.15%	3.94%	NA
Temperate Japonica	767	99.00%	0.80%	0.26%	0.00%	NA
Tropical Japonica	504	98.80%	1.00%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	68.90%	28.90%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820681231	T -> C	LOC_Os08g33200-LOC_Os08g33210	intergenic_region ; MODIFIER	silent_mutation	Average:66.234; most accessible tissue: Minghui63 flower, score: 79.158	N	N	N	N
vg0820681231	T -> DEL	N	N	silent_mutation	Average:66.234; most accessible tissue: Minghui63 flower, score: 79.158	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0820681231	T	C	-0.05	-0.03	-0.03	-0.09	-0.07	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820681231	NA	4.17E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	3.09E-07	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	2.33E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	3.68E-07	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	8.21E-08	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	1.52E-06	mr1146_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	5.23E-07	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	1.89E-06	4.93E-08	mr1222_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	8.64E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	7.80E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	7.35E-07	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820681231	NA	7.18E-07	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251