RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0820602655:

Variant ID: vg0820602655 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20602655
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGAGGTACCATGACTCCATGAGGTACCTCATAATATCTAGGTATCAAATTTACAATAGAAAAAATAATACCTCATGGTATCATTTCAAGGACTGTAAAA[T/C]
TGCTTTTTTTTTATGTCATGTGCACTTGCACGCGTGCATGCAGATGCCGTAATGCTAAAGGAAAATAAATTCAGGAGAGAAATTAAAGAATGAGACCTAC

Reverse complement sequence

GTAGGTCTCATTCTTTAATTTCTCTCCTGAATTTATTTTCCTTTAGCATTACGGCATCTGCATGCACGCGTGCAAGTGCACATGACATAAAAAAAAAGCA[A/G]
TTTTACAGTCCTTGAAATGATACCATGAGGTATTATTTTTTCTATTGTAAATTTGATACCTAGATATTATGAGGTACCTCATGGAGTCATGGTACCTCCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	5.80%	2.75%	52.43%	NA
All Indica	2759	45.10%	9.10%	3.44%	42.37%	NA
All Japonica	1512	20.00%	0.10%	1.79%	78.17%	NA
Aus	269	92.60%	5.20%	1.86%	0.37%	NA
Indica I	595	66.20%	4.00%	5.55%	24.20%	NA
Indica II	465	69.50%	1.30%	2.58%	26.67%	NA
Indica III	913	17.20%	18.20%	4.05%	60.57%	NA
Indica Intermediate	786	46.90%	7.10%	1.65%	44.27%	NA
Temperate Japonica	767	30.20%	0.00%	1.83%	67.93%	NA
Tropical Japonica	504	10.10%	0.00%	1.98%	87.90%	NA
Japonica Intermediate	241	7.90%	0.40%	1.24%	90.46%	NA
VI/Aromatic	96	16.70%	2.10%	0.00%	81.25%	NA
Intermediate	90	36.70%	6.70%	3.33%	53.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820602655	T -> C	LOC_Os08g33150.1	downstream_gene_variant ; 660.0bp to feature; MODIFIER	silent_mutation	Average:54.76; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0820602655	T -> C	LOC_Os08g33150-LOC_Os08g33154	intergenic_region ; MODIFIER	silent_mutation	Average:54.76; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0820602655	T -> DEL	N	N	silent_mutation	Average:54.76; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820602655	NA	1.35E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655	NA	8.80E-06	mr1817	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655	NA	8.44E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655	NA	1.92E-08	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655	NA	1.98E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655	NA	3.61E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655	NA	1.04E-07	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655	NA	2.98E-09	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655	NA	2.92E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655	NA	4.84E-07	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 12 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0820602655:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact