\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820602655:

Variant ID: vg0820602655 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20602655
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAGGTACCATGACTCCATGAGGTACCTCATAATATCTAGGTATCAAATTTACAATAGAAAAAATAATACCTCATGGTATCATTTCAAGGACTGTAAAA[T/C]
TGCTTTTTTTTTATGTCATGTGCACTTGCACGCGTGCATGCAGATGCCGTAATGCTAAAGGAAAATAAATTCAGGAGAGAAATTAAAGAATGAGACCTAC

Reverse complement sequence

GTAGGTCTCATTCTTTAATTTCTCTCCTGAATTTATTTTCCTTTAGCATTACGGCATCTGCATGCACGCGTGCAAGTGCACATGACATAAAAAAAAAGCA[A/G]
TTTTACAGTCCTTGAAATGATACCATGAGGTATTATTTTTTCTATTGTAAATTTGATACCTAGATATTATGAGGTACCTCATGGAGTCATGGTACCTCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.00% 5.80% 2.75% 52.43% NA
All Indica  2759 45.10% 9.10% 3.44% 42.37% NA
All Japonica  1512 20.00% 0.10% 1.79% 78.17% NA
Aus  269 92.60% 5.20% 1.86% 0.37% NA
Indica I  595 66.20% 4.00% 5.55% 24.20% NA
Indica II  465 69.50% 1.30% 2.58% 26.67% NA
Indica III  913 17.20% 18.20% 4.05% 60.57% NA
Indica Intermediate  786 46.90% 7.10% 1.65% 44.27% NA
Temperate Japonica  767 30.20% 0.00% 1.83% 67.93% NA
Tropical Japonica  504 10.10% 0.00% 1.98% 87.90% NA
Japonica Intermediate  241 7.90% 0.40% 1.24% 90.46% NA
VI/Aromatic  96 16.70% 2.10% 0.00% 81.25% NA
Intermediate  90 36.70% 6.70% 3.33% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820602655 T -> C LOC_Os08g33150.1 downstream_gene_variant ; 660.0bp to feature; MODIFIER silent_mutation Average:54.76; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0820602655 T -> C LOC_Os08g33150-LOC_Os08g33154 intergenic_region ; MODIFIER silent_mutation Average:54.76; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0820602655 T -> DEL N N silent_mutation Average:54.76; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820602655 NA 1.35E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 8.80E-06 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 8.44E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 1.92E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 1.98E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 3.61E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 1.04E-07 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 2.98E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 2.92E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 4.84E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 1.37E-10 mr1870_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820602655 NA 1.31E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251