Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820524101:

Variant ID: vg0820524101 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20524101
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCTAGGACGTACTTAATTATATTTATTCAGTAGCCGTCATTGTTTAGAGTCGGGTTTTGCTTAGATTATTTTTTTTCGTTGCAATTTCGCCGCTAGTTC[G/A]
GTTTGTGGAACCCTAACCTTAAAATCTTAATCATTCAGCTTCAAATTGAGTTGCAATTTGCATTATTCTTACTTGTATTCTTCGTTGATTCACATGTAGG

Reverse complement sequence

CCTACATGTGAATCAACGAAGAATACAAGTAAGAATAATGCAAATTGCAACTCAATTTGAAGCTGAATGATTAAGATTTTAAGGTTAGGGTTCCACAAAC[C/T]
GAACTAGCGGCGAAATTGCAACGAAAAAAAATAATCTAAGCAAAACCCGACTCTAAACAATGACGGCTACTGAATAAATATAATTAAGTACGTCCTAGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	9.60%	0.68%	0.00%	NA
All Indica	2759	96.00%	3.80%	0.22%	0.00%	NA
All Japonica	1512	79.80%	18.60%	1.59%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	94.10%	5.80%	0.11%	0.00%	NA
Indica Intermediate	786	95.00%	4.50%	0.51%	0.00%	NA
Temperate Japonica	767	96.90%	2.00%	1.17%	0.00%	NA
Tropical Japonica	504	53.40%	44.40%	2.18%	0.00%	NA
Japonica Intermediate	241	80.90%	17.40%	1.66%	0.00%	NA
VI/Aromatic	96	46.90%	52.10%	1.04%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820524101	G -> A	LOC_Os08g33045.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:45.128; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg0820524101	G -> A	LOC_Os08g33045.1	5_prime_UTR_variant ; 960.0bp to feature; MODIFIER	silent_mutation	Average:45.128; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg0820524101	G -> A	LOC_Os08g33050.1	upstream_gene_variant ; 4191.0bp to feature; MODIFIER	silent_mutation	Average:45.128; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg0820524101	G -> A	LOC_Os08g33040.1	downstream_gene_variant ; 4141.0bp to feature; MODIFIER	silent_mutation	Average:45.128; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820524101	NA	5.94E-07	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	NA	8.45E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	NA	6.51E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	NA	1.20E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	NA	9.02E-06	mr1088_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	2.67E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	NA	5.33E-07	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	2.03E-07	NA	mr1233_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	7.86E-06	NA	mr1404_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	NA	8.35E-08	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820524101	5.77E-06	NA	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251