\
| Variant ID: vg0820524101 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20524101 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCCTAGGACGTACTTAATTATATTTATTCAGTAGCCGTCATTGTTTAGAGTCGGGTTTTGCTTAGATTATTTTTTTTCGTTGCAATTTCGCCGCTAGTTC[G/A]
GTTTGTGGAACCCTAACCTTAAAATCTTAATCATTCAGCTTCAAATTGAGTTGCAATTTGCATTATTCTTACTTGTATTCTTCGTTGATTCACATGTAGG
CCTACATGTGAATCAACGAAGAATACAAGTAAGAATAATGCAAATTGCAACTCAATTTGAAGCTGAATGATTAAGATTTTAAGGTTAGGGTTCCACAAAC[C/T]
GAACTAGCGGCGAAATTGCAACGAAAAAAAATAATCTAAGCAAAACCCGACTCTAAACAATGACGGCTACTGAATAAATATAATTAAGTACGTCCTAGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.70% | 9.60% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 96.00% | 3.80% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 79.80% | 18.60% | 1.59% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.10% | 5.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 4.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 2.00% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 53.40% | 44.40% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 17.40% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 46.90% | 52.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820524101 | G -> A | LOC_Os08g33045.1 | 5_prime_UTR_premature_start_codon_gain_variant ; LOW | silent_mutation | Average:45.128; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| vg0820524101 | G -> A | LOC_Os08g33045.1 | 5_prime_UTR_variant ; 960.0bp to feature; MODIFIER | silent_mutation | Average:45.128; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| vg0820524101 | G -> A | LOC_Os08g33050.1 | upstream_gene_variant ; 4191.0bp to feature; MODIFIER | silent_mutation | Average:45.128; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| vg0820524101 | G -> A | LOC_Os08g33040.1 | downstream_gene_variant ; 4141.0bp to feature; MODIFIER | silent_mutation | Average:45.128; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820524101 | NA | 5.94E-07 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | NA | 8.45E-06 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | NA | 6.51E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | NA | 1.20E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | NA | 9.02E-06 | mr1088_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | 2.67E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | NA | 5.33E-07 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | 2.03E-07 | NA | mr1233_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | 7.86E-06 | NA | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | NA | 8.35E-08 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820524101 | 5.77E-06 | NA | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |