Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820479181:

Variant ID: vg0820479181 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20479181
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAATGTAGGTATCATTAAGTTATTTTGCTTTTGAAAGAGGAACCACCTGTCAGGGAAAAAAGACTGGTGCATGACAAGGGGAAAAAAGTAGTCGCAAAG[A/T]
AAATTCGCAAACGAAGTTAGGTTTAGATGTAAAACCACAATTATGGTCTCTGGTTGACTTTACTAAAAAAGATGAGTGGTTTTGTTGTAAGAATGTTAAC

Reverse complement sequence

GTTAACATTCTTACAACAAAACCACTCATCTTTTTTAGTAAAGTCAACCAGAGACCATAATTGTGGTTTTACATCTAAACCTAACTTCGTTTGCGAATTT[T/A]
CTTTGCGACTACTTTTTTCCCCTTGTCATGCACCAGTCTTTTTTCCCTGACAGGTGGTTCCTCTTTCAAAAGCAAAATAACTTAATGATACCTACATTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.70%	3.20%	1.99%	50.06%	NA
All Indica	2759	17.10%	1.20%	2.97%	78.80%	NA
All Japonica	1512	97.60%	0.10%	0.20%	2.12%	NA
Aus	269	4.80%	42.80%	2.97%	49.44%	NA
Indica I	595	6.70%	1.50%	3.87%	87.90%	NA
Indica II	465	20.90%	0.20%	4.09%	74.84%	NA
Indica III	913	19.30%	1.00%	2.30%	77.44%	NA
Indica Intermediate	786	20.10%	1.70%	2.42%	75.83%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	94.20%	0.00%	0.60%	5.16%	NA
Japonica Intermediate	241	97.90%	0.40%	0.00%	1.66%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	70.00%	4.40%	1.11%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820479181	A -> T	LOC_Os08g33000.1	downstream_gene_variant ; 228.0bp to feature; MODIFIER	silent_mutation	Average:36.369; most accessible tissue: Callus, score: 79.285	N	N	N	N
vg0820479181	A -> T	LOC_Os08g33010.1	downstream_gene_variant ; 911.0bp to feature; MODIFIER	silent_mutation	Average:36.369; most accessible tissue: Callus, score: 79.285	N	N	N	N
vg0820479181	A -> T	LOC_Os08g33020.1	downstream_gene_variant ; 3164.0bp to feature; MODIFIER	silent_mutation	Average:36.369; most accessible tissue: Callus, score: 79.285	N	N	N	N
vg0820479181	A -> T	LOC_Os08g33000-LOC_Os08g33010	intergenic_region ; MODIFIER	silent_mutation	Average:36.369; most accessible tissue: Callus, score: 79.285	N	N	N	N
vg0820479181	A -> DEL	N	N	silent_mutation	Average:36.369; most accessible tissue: Callus, score: 79.285	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820479181	NA	1.74E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181	NA	1.55E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181	NA	5.01E-08	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181	NA	5.41E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181	NA	4.91E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181	NA	1.23E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181	NA	7.14E-09	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181	NA	5.28E-06	mr1976	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181	NA	5.45E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181	3.81E-07	NA	mr1793_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251