\
| Variant ID: vg0820479181 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20479181 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAATGTAGGTATCATTAAGTTATTTTGCTTTTGAAAGAGGAACCACCTGTCAGGGAAAAAAGACTGGTGCATGACAAGGGGAAAAAAGTAGTCGCAAAG[A/T]
AAATTCGCAAACGAAGTTAGGTTTAGATGTAAAACCACAATTATGGTCTCTGGTTGACTTTACTAAAAAAGATGAGTGGTTTTGTTGTAAGAATGTTAAC
GTTAACATTCTTACAACAAAACCACTCATCTTTTTTAGTAAAGTCAACCAGAGACCATAATTGTGGTTTTACATCTAAACCTAACTTCGTTTGCGAATTT[T/A]
CTTTGCGACTACTTTTTTCCCCTTGTCATGCACCAGTCTTTTTTCCCTGACAGGTGGTTCCTCTTTCAAAAGCAAAATAACTTAATGATACCTACATTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.70% | 3.20% | 1.99% | 50.06% | NA |
| All Indica | 2759 | 17.10% | 1.20% | 2.97% | 78.80% | NA |
| All Japonica | 1512 | 97.60% | 0.10% | 0.20% | 2.12% | NA |
| Aus | 269 | 4.80% | 42.80% | 2.97% | 49.44% | NA |
| Indica I | 595 | 6.70% | 1.50% | 3.87% | 87.90% | NA |
| Indica II | 465 | 20.90% | 0.20% | 4.09% | 74.84% | NA |
| Indica III | 913 | 19.30% | 1.00% | 2.30% | 77.44% | NA |
| Indica Intermediate | 786 | 20.10% | 1.70% | 2.42% | 75.83% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 94.20% | 0.00% | 0.60% | 5.16% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.40% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 70.00% | 4.40% | 1.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820479181 | A -> T | LOC_Os08g33000.1 | downstream_gene_variant ; 228.0bp to feature; MODIFIER | silent_mutation | Average:36.369; most accessible tissue: Callus, score: 79.285 | N | N | N | N |
| vg0820479181 | A -> T | LOC_Os08g33010.1 | downstream_gene_variant ; 911.0bp to feature; MODIFIER | silent_mutation | Average:36.369; most accessible tissue: Callus, score: 79.285 | N | N | N | N |
| vg0820479181 | A -> T | LOC_Os08g33020.1 | downstream_gene_variant ; 3164.0bp to feature; MODIFIER | silent_mutation | Average:36.369; most accessible tissue: Callus, score: 79.285 | N | N | N | N |
| vg0820479181 | A -> T | LOC_Os08g33000-LOC_Os08g33010 | intergenic_region ; MODIFIER | silent_mutation | Average:36.369; most accessible tissue: Callus, score: 79.285 | N | N | N | N |
| vg0820479181 | A -> DEL | N | N | silent_mutation | Average:36.369; most accessible tissue: Callus, score: 79.285 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820479181 | NA | 1.74E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820479181 | NA | 1.55E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820479181 | NA | 5.01E-08 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820479181 | NA | 5.41E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820479181 | NA | 4.91E-07 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820479181 | NA | 1.23E-06 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820479181 | NA | 7.14E-09 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820479181 | NA | 5.28E-06 | mr1976 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820479181 | NA | 5.45E-07 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820479181 | 3.81E-07 | NA | mr1793_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |