\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820479181:

Variant ID: vg0820479181 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20479181
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAATGTAGGTATCATTAAGTTATTTTGCTTTTGAAAGAGGAACCACCTGTCAGGGAAAAAAGACTGGTGCATGACAAGGGGAAAAAAGTAGTCGCAAAG[A/T]
AAATTCGCAAACGAAGTTAGGTTTAGATGTAAAACCACAATTATGGTCTCTGGTTGACTTTACTAAAAAAGATGAGTGGTTTTGTTGTAAGAATGTTAAC

Reverse complement sequence

GTTAACATTCTTACAACAAAACCACTCATCTTTTTTAGTAAAGTCAACCAGAGACCATAATTGTGGTTTTACATCTAAACCTAACTTCGTTTGCGAATTT[T/A]
CTTTGCGACTACTTTTTTCCCCTTGTCATGCACCAGTCTTTTTTCCCTGACAGGTGGTTCCTCTTTCAAAAGCAAAATAACTTAATGATACCTACATTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.70% 3.20% 1.99% 50.06% NA
All Indica  2759 17.10% 1.20% 2.97% 78.80% NA
All Japonica  1512 97.60% 0.10% 0.20% 2.12% NA
Aus  269 4.80% 42.80% 2.97% 49.44% NA
Indica I  595 6.70% 1.50% 3.87% 87.90% NA
Indica II  465 20.90% 0.20% 4.09% 74.84% NA
Indica III  913 19.30% 1.00% 2.30% 77.44% NA
Indica Intermediate  786 20.10% 1.70% 2.42% 75.83% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 94.20% 0.00% 0.60% 5.16% NA
Japonica Intermediate  241 97.90% 0.40% 0.00% 1.66% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 70.00% 4.40% 1.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820479181 A -> T LOC_Os08g33000.1 downstream_gene_variant ; 228.0bp to feature; MODIFIER silent_mutation Average:36.369; most accessible tissue: Callus, score: 79.285 N N N N
vg0820479181 A -> T LOC_Os08g33010.1 downstream_gene_variant ; 911.0bp to feature; MODIFIER silent_mutation Average:36.369; most accessible tissue: Callus, score: 79.285 N N N N
vg0820479181 A -> T LOC_Os08g33020.1 downstream_gene_variant ; 3164.0bp to feature; MODIFIER silent_mutation Average:36.369; most accessible tissue: Callus, score: 79.285 N N N N
vg0820479181 A -> T LOC_Os08g33000-LOC_Os08g33010 intergenic_region ; MODIFIER silent_mutation Average:36.369; most accessible tissue: Callus, score: 79.285 N N N N
vg0820479181 A -> DEL N N silent_mutation Average:36.369; most accessible tissue: Callus, score: 79.285 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820479181 NA 1.74E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181 NA 1.55E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181 NA 5.01E-08 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181 NA 5.41E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181 NA 4.91E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181 NA 1.23E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181 NA 7.14E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181 NA 5.28E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181 NA 5.45E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820479181 3.81E-07 NA mr1793_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251