\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820478740:

Variant ID: vg0820478740 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20478740
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.05, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTCGTCATTTATACTATTATGCGGTCTGTGTGCCAGCACTGTAGTTAGAAAGGACCACTCTTGCAAGGATATTTCTCCACTCTTGCAAGGACCACTCT[T/C]
GAACGCCAACGGATTAAATTAAATTTTCATTTACTCGATTTTAATCGAACGGTGATTTACGGGTTTGCTTTGGATTGGCTAGATTGGGAAGAATGCTCTC

Reverse complement sequence

GAGAGCATTCTTCCCAATCTAGCCAATCCAAAGCAAACCCGTAAATCACCGTTCGATTAAAATCGAGTAAATGAAAATTTAATTTAATCCGTTGGCGTTC[A/G]
AGAGTGGTCCTTGCAAGAGTGGAGAAATATCCTTGCAAGAGTGGTCCTTTCTAACTACAGTGCTGGCACACAGACCGCATAATAGTATAAATGACGACTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.80% 3.40% 2.92% 49.92% NA
All Indica  2759 15.70% 1.30% 4.64% 78.29% NA
All Japonica  1512 97.40% 0.10% 0.20% 2.25% NA
Aus  269 4.10% 42.80% 1.86% 51.30% NA
Indica I  595 5.20% 1.70% 5.71% 87.39% NA
Indica II  465 19.10% 0.40% 6.67% 73.76% NA
Indica III  913 18.50% 0.90% 2.85% 77.77% NA
Indica Intermediate  786 18.40% 2.20% 4.71% 74.68% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 93.80% 0.00% 0.60% 5.56% NA
Japonica Intermediate  241 97.50% 0.80% 0.00% 1.66% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 66.70% 6.70% 2.22% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820478740 T -> C LOC_Os08g33010.1 downstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:45.715; most accessible tissue: Callus, score: 76.032 N N N N
vg0820478740 T -> C LOC_Os08g33020.1 downstream_gene_variant ; 3605.0bp to feature; MODIFIER silent_mutation Average:45.715; most accessible tissue: Callus, score: 76.032 N N N N
vg0820478740 T -> C LOC_Os08g33000.1 intron_variant ; MODIFIER silent_mutation Average:45.715; most accessible tissue: Callus, score: 76.032 N N N N
vg0820478740 T -> DEL N N silent_mutation Average:45.715; most accessible tissue: Callus, score: 76.032 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820478740 NA 1.13E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 1.67E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 9.36E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 6.69E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 1.01E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 1.17E-07 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 6.24E-06 6.24E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 1.53E-06 1.53E-06 mr1384_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 1.36E-25 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 2.08E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 3.35E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 2.53E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 9.76E-06 9.76E-06 mr1433_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 1.74E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 6.41E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 8.17E-06 mr1554_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 5.19E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 1.36E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 5.44E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 5.29E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 1.06E-06 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 2.22E-19 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 NA 2.85E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820478740 5.55E-07 1.86E-08 mr1956_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251