Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820208654:

Variant ID: vg0820208654 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20208654
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTTAGCTTATAAGCCTAAACAAAGATGGCCTTAGTTGTAAACTTTTAACTTTTCCAGCACATCAAAATTTTTCTACACACACAAACTTCTAACTTTT[C/T]
CGTCGCATTGTTCTAATTTCAACCAAAATTTTAATTTTATGGTGGACTAAACACACCCTTTGTACAGTTGGTCCGAACAGATAAGAGTAAGAGACGGCGT

Reverse complement sequence

ACGCCGTCTCTTACTCTTATCTGTTCGGACCAACTGTACAAAGGGTGTGTTTAGTCCACCATAAAATTAAAATTTTGGTTGAAATTAGAACAATGCGACG[G/A]
AAAAGTTAGAAGTTTGTGTGTGTAGAAAAATTTTGATGTGCTGGAAAAGTTAAAAGTTTACAACTAAGGCCATCTTTGTTTAGGCTTATAAGCTAACTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 4.30% 2.71% 11.98% NA
All Indica  2759 78.30% 4.00% 1.96% 15.77% NA
All Japonica  1512 82.90% 5.10% 4.50% 7.54% NA
Aus  269 93.70% 1.10% 1.12% 4.09% NA
Indica I  595 77.50% 0.00% 2.69% 19.83% NA
Indica II  465 94.60% 3.00% 0.22% 2.15% NA
Indica III  913 67.00% 5.00% 2.30% 25.63% NA
Indica Intermediate  786 82.30% 6.40% 2.04% 9.29% NA
Temperate Japonica  767 87.90% 5.50% 6.52% 0.13% NA
Tropical Japonica  504 76.20% 1.20% 1.59% 21.03% NA
Japonica Intermediate  241 80.90% 12.00% 4.15% 2.90% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 83.30% 6.70% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820208654 C -> T LOC_Os08g32630.1 upstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> T LOC_Os08g32630.2 upstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> T LOC_Os08g32630.4 upstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> T LOC_Os08g32630.5 upstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> T LOC_Os08g32630.3 upstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> T LOC_Os08g32620.1 downstream_gene_variant ; 599.0bp to feature; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> T LOC_Os08g32620.2 downstream_gene_variant ; 599.0bp to feature; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> T LOC_Os08g32620.4 downstream_gene_variant ; 599.0bp to feature; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> T LOC_Os08g32620.3 downstream_gene_variant ; 599.0bp to feature; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> T LOC_Os08g32620-LOC_Os08g32630 intergenic_region ; MODIFIER silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N
vg0820208654 C -> DEL N N silent_mutation Average:95.406; most accessible tissue: Zhenshan97 young leaf, score: 99.391 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820208654 C T 0.0 0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820208654 5.79E-06 NA Grain_width Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652