\
| Variant ID: vg0820203875 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20203875 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCATCTCTTCTGGAACTAGAGCGTAACCAAACGGTTTCAGTTTCACCCCAAAAAAGGAATAGAGTCGGCTAGAGTGCTCTCACAAAATAAACCAGAGAG[G/A]
TGGAGATAGATTTAGGTAGCTCCACAACTCCACTCCAGACCGAACACTTAGAGTTAAACTTAGGGGTTGGAGCCCTATCAAACGGATCATTCATTTTGTG
CACAAAATGAATGATCCGTTTGATAGGGCTCCAACCCCTAAGTTTAACTCTAAGTGTTCGGTCTGGAGTGGAGTTGTGGAGCTACCTAAATCTATCTCCA[C/T]
CTCTCTGGTTTATTTTGTGAGAGCACTCTAGCCGACTCTATTCCTTTTTTGGGGTGAAACTGAAACCGTTTGGTTACGCTCTAGTTCCAGAAGAGATGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.80% | 18.30% | 0.87% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.00% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 48.60% | 49.30% | 2.05% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 64.40% | 32.90% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 31.30% | 67.90% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.40% | 63.10% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 72.90% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 24.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820203875 | G -> A | LOC_Os08g32620.1 | upstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0820203875 | G -> A | LOC_Os08g32630.1 | upstream_gene_variant ; 4985.0bp to feature; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0820203875 | G -> A | LOC_Os08g32620.2 | upstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0820203875 | G -> A | LOC_Os08g32620.4 | upstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0820203875 | G -> A | LOC_Os08g32620.3 | upstream_gene_variant ; 756.0bp to feature; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0820203875 | G -> A | LOC_Os08g32630.2 | upstream_gene_variant ; 4985.0bp to feature; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0820203875 | G -> A | LOC_Os08g32630.4 | upstream_gene_variant ; 4985.0bp to feature; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0820203875 | G -> A | LOC_Os08g32630.5 | upstream_gene_variant ; 4985.0bp to feature; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0820203875 | G -> A | LOC_Os08g32630.3 | upstream_gene_variant ; 4985.0bp to feature; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0820203875 | G -> A | LOC_Os08g32610-LOC_Os08g32620 | intergenic_region ; MODIFIER | silent_mutation | Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820203875 | NA | 7.20E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 2.90E-09 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 3.28E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | 1.24E-07 | NA | mr1530 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 4.66E-07 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 8.38E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 3.44E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 6.30E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 9.03E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 2.36E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 2.30E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 8.84E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 4.64E-09 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 1.23E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820203875 | NA | 4.38E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |