\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820203875:

Variant ID: vg0820203875 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20203875
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCATCTCTTCTGGAACTAGAGCGTAACCAAACGGTTTCAGTTTCACCCCAAAAAAGGAATAGAGTCGGCTAGAGTGCTCTCACAAAATAAACCAGAGAG[G/A]
TGGAGATAGATTTAGGTAGCTCCACAACTCCACTCCAGACCGAACACTTAGAGTTAAACTTAGGGGTTGGAGCCCTATCAAACGGATCATTCATTTTGTG

Reverse complement sequence

CACAAAATGAATGATCCGTTTGATAGGGCTCCAACCCCTAAGTTTAACTCTAAGTGTTCGGTCTGGAGTGGAGTTGTGGAGCTACCTAAATCTATCTCCA[C/T]
CTCTCTGGTTTATTTTGTGAGAGCACTCTAGCCGACTCTATTCCTTTTTTGGGGTGAAACTGAAACCGTTTGGTTACGCTCTAGTTCCAGAAGAGATGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 18.30% 0.87% 0.00% NA
All Indica  2759 98.80% 1.00% 0.22% 0.00% NA
All Japonica  1512 48.60% 49.30% 2.05% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.50% 1.40% 0.11% 0.00% NA
Indica Intermediate  786 98.50% 1.00% 0.51% 0.00% NA
Temperate Japonica  767 64.40% 32.90% 2.74% 0.00% NA
Tropical Japonica  504 31.30% 67.90% 0.79% 0.00% NA
Japonica Intermediate  241 34.40% 63.10% 2.49% 0.00% NA
VI/Aromatic  96 25.00% 72.90% 2.08% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820203875 G -> A LOC_Os08g32620.1 upstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0820203875 G -> A LOC_Os08g32630.1 upstream_gene_variant ; 4985.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0820203875 G -> A LOC_Os08g32620.2 upstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0820203875 G -> A LOC_Os08g32620.4 upstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0820203875 G -> A LOC_Os08g32620.3 upstream_gene_variant ; 756.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0820203875 G -> A LOC_Os08g32630.2 upstream_gene_variant ; 4985.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0820203875 G -> A LOC_Os08g32630.4 upstream_gene_variant ; 4985.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0820203875 G -> A LOC_Os08g32630.5 upstream_gene_variant ; 4985.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0820203875 G -> A LOC_Os08g32630.3 upstream_gene_variant ; 4985.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0820203875 G -> A LOC_Os08g32610-LOC_Os08g32620 intergenic_region ; MODIFIER silent_mutation Average:59.807; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820203875 NA 7.20E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 2.90E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 3.28E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 1.24E-07 NA mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 4.66E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 8.38E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 3.44E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 6.30E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 9.03E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 2.36E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 2.30E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 8.84E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 4.64E-09 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 1.23E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820203875 NA 4.38E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251