\
| Variant ID: vg0820151458 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20151458 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, A: 0.24, others allele: 0.00, population size: 107. )
GCTGTCGCTGGCTACCCACCTTGCCATCGTACCGCGCTGCAACAGCCAGCGGGCTTCATCCACGACCACACGTCACCCGCGTACGAGATTAAGGGCACCA[A/C]
TGGTCATTCCTGTCACCACCCTCCTTGCTCACCGCACGGTTTTTCCAGTGGCGGCAGGATAGATGGTGGGAAGGAGGCCAGGCAACGCTGGATCTGCGGT
ACCGCAGATCCAGCGTTGCCTGGCCTCCTTCCCACCATCTATCCTGCCGCCACTGGAAAAACCGTGCGGTGAGCAAGGAGGGTGGTGACAGGAATGACCA[T/G]
TGGTGCCCTTAATCTCGTACGCGGGTGACGTGTGGTCGTGGATGAAGCCCGCTGGCTGTTGCAGCGCGGTACGATGGCAAGGTGGGTAGCCAGCGACAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.10% | 10.90% | 0.32% | 53.70% | NA |
| All Indica | 2759 | 22.50% | 1.10% | 0.25% | 76.19% | NA |
| All Japonica | 1512 | 59.40% | 30.90% | 0.26% | 9.46% | NA |
| Aus | 269 | 3.30% | 0.70% | 0.00% | 95.91% | NA |
| Indica I | 595 | 3.70% | 0.70% | 0.17% | 95.46% | NA |
| Indica II | 465 | 20.20% | 1.50% | 0.00% | 78.28% | NA |
| Indica III | 913 | 31.30% | 0.10% | 0.44% | 68.13% | NA |
| Indica Intermediate | 786 | 27.90% | 2.20% | 0.25% | 69.72% | NA |
| Temperate Japonica | 767 | 45.80% | 53.30% | 0.13% | 0.78% | NA |
| Tropical Japonica | 504 | 70.40% | 5.40% | 0.20% | 24.01% | NA |
| Japonica Intermediate | 241 | 79.70% | 12.90% | 0.83% | 6.64% | NA |
| VI/Aromatic | 96 | 90.60% | 1.00% | 1.04% | 7.29% | NA |
| Intermediate | 90 | 50.00% | 15.60% | 3.33% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820151458 | A -> C | LOC_Os08g32530.1 | missense_variant ; p.Asn52Thr; MODERATE | nonsynonymous_codon | Average:48.224; most accessible tissue: Callus, score: 91.021 | unknown | unknown | TOLERATED | 0.06 |
| vg0820151458 | A -> DEL | LOC_Os08g32530.1 | N | frameshift_variant | Average:48.224; most accessible tissue: Callus, score: 91.021 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820151458 | NA | 9.15E-13 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 1.02E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 1.12E-11 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 7.80E-10 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 1.12E-09 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 4.18E-06 | mr1910 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 1.14E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 2.57E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 1.52E-17 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 2.66E-08 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 4.28E-08 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 1.15E-13 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 9.17E-07 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 9.32E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 6.47E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 2.14E-08 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 1.62E-07 | mr1606_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 1.89E-07 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 3.72E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | 2.93E-06 | NA | mr1670_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 6.22E-09 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 2.08E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 1.79E-18 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820151458 | NA | 3.20E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |