\
| Variant ID: vg0820147127 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20147127 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATTACTGCTGATGCGCATGTCTAATGTCTTGATAGTTTGGTTCTTTGGTCAATTTTACCTGCTCATATATGGCGGTGTTTAGTTTCCCTCTATTCCCAA[C/T]
TTTCCATCATATTATATCACATCAAAAACTTTTTTACACATATAAACTTTTAACTTTTTCTTCAAACTTTCAACTTTCTTCAAACCTTCAACTTTTTTTT
AAAAAAAAGTTGAAGGTTTGAAGAAAGTTGAAAGTTTGAAGAAAAAGTTAAAAGTTTATATGTGTAAAAAAGTTTTTGATGTGATATAATATGATGGAAA[G/A]
TTGGGAATAGAGGGAAACTAAACACCGCCATATATGAGCAGGTAAAATTGACCAAAGAACCAAACTATCAAGACATTAGACATGCGCATCAGCAGTAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.40% | 23.60% | 0.47% | 4.61% | NA |
| All Indica | 2759 | 87.80% | 4.30% | 0.29% | 7.54% | NA |
| All Japonica | 1512 | 40.90% | 58.30% | 0.66% | 0.13% | NA |
| Aus | 269 | 97.80% | 1.10% | 0.37% | 0.74% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 85.20% | 5.20% | 0.43% | 9.25% | NA |
| Indica III | 913 | 83.10% | 5.00% | 0.11% | 11.72% | NA |
| Indica Intermediate | 786 | 86.50% | 5.60% | 0.51% | 7.38% | NA |
| Temperate Japonica | 767 | 54.40% | 45.40% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 30.40% | 68.70% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 19.90% | 78.00% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 15.60% | 82.30% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 60.00% | 32.20% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820147127 | C -> T | LOC_Os08g32530.1 | upstream_gene_variant ; 4177.0bp to feature; MODIFIER | silent_mutation | Average:69.018; most accessible tissue: Callus, score: 88.757 | N | N | N | N |
| vg0820147127 | C -> T | LOC_Os08g32520.1 | downstream_gene_variant ; 1580.0bp to feature; MODIFIER | silent_mutation | Average:69.018; most accessible tissue: Callus, score: 88.757 | N | N | N | N |
| vg0820147127 | C -> T | LOC_Os08g32520-LOC_Os08g32530 | intergenic_region ; MODIFIER | silent_mutation | Average:69.018; most accessible tissue: Callus, score: 88.757 | N | N | N | N |
| vg0820147127 | C -> DEL | N | N | silent_mutation | Average:69.018; most accessible tissue: Callus, score: 88.757 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820147127 | NA | 2.46E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 2.02E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 2.09E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | 1.05E-06 | 1.91E-07 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 1.89E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | 5.60E-06 | 4.69E-07 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 8.89E-10 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 4.36E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | 4.45E-08 | 3.85E-09 | mr1446 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 4.76E-07 | mr1773 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 5.14E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 5.14E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 9.46E-08 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 1.14E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 8.71E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820147127 | NA | 6.11E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |