\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820147127:

Variant ID: vg0820147127 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20147127
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTACTGCTGATGCGCATGTCTAATGTCTTGATAGTTTGGTTCTTTGGTCAATTTTACCTGCTCATATATGGCGGTGTTTAGTTTCCCTCTATTCCCAA[C/T]
TTTCCATCATATTATATCACATCAAAAACTTTTTTACACATATAAACTTTTAACTTTTTCTTCAAACTTTCAACTTTCTTCAAACCTTCAACTTTTTTTT

Reverse complement sequence

AAAAAAAAGTTGAAGGTTTGAAGAAAGTTGAAAGTTTGAAGAAAAAGTTAAAAGTTTATATGTGTAAAAAAGTTTTTGATGTGATATAATATGATGGAAA[G/A]
TTGGGAATAGAGGGAAACTAAACACCGCCATATATGAGCAGGTAAAATTGACCAAAGAACCAAACTATCAAGACATTAGACATGCGCATCAGCAGTAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 23.60% 0.47% 4.61% NA
All Indica  2759 87.80% 4.30% 0.29% 7.54% NA
All Japonica  1512 40.90% 58.30% 0.66% 0.13% NA
Aus  269 97.80% 1.10% 0.37% 0.74% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 85.20% 5.20% 0.43% 9.25% NA
Indica III  913 83.10% 5.00% 0.11% 11.72% NA
Indica Intermediate  786 86.50% 5.60% 0.51% 7.38% NA
Temperate Japonica  767 54.40% 45.40% 0.26% 0.00% NA
Tropical Japonica  504 30.40% 68.70% 0.79% 0.20% NA
Japonica Intermediate  241 19.90% 78.00% 1.66% 0.41% NA
VI/Aromatic  96 15.60% 82.30% 0.00% 2.08% NA
Intermediate  90 60.00% 32.20% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820147127 C -> T LOC_Os08g32530.1 upstream_gene_variant ; 4177.0bp to feature; MODIFIER silent_mutation Average:69.018; most accessible tissue: Callus, score: 88.757 N N N N
vg0820147127 C -> T LOC_Os08g32520.1 downstream_gene_variant ; 1580.0bp to feature; MODIFIER silent_mutation Average:69.018; most accessible tissue: Callus, score: 88.757 N N N N
vg0820147127 C -> T LOC_Os08g32520-LOC_Os08g32530 intergenic_region ; MODIFIER silent_mutation Average:69.018; most accessible tissue: Callus, score: 88.757 N N N N
vg0820147127 C -> DEL N N silent_mutation Average:69.018; most accessible tissue: Callus, score: 88.757 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820147127 NA 2.46E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 2.02E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 2.09E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 1.05E-06 1.91E-07 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 1.89E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 5.60E-06 4.69E-07 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 8.89E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 4.36E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 4.45E-08 3.85E-09 mr1446 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 4.76E-07 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 5.14E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 5.14E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 9.46E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 1.14E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 8.71E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820147127 NA 6.11E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251