Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820144025:

Variant ID: vg0820144025 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20144025
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GCCCTTAGAATTTGTCCTAAAATATAACAACTTTTCTATCAACATTCTCTTCCGAACCAATCATAACCATCCACCATTCACTTTCCCACCTACCTCCACT[A/G]
TTTATCCAATCTATTTAGAACATTCACTTACCTATTTAATGACGGGGACTACTACTTGTGGATGGAGAAGTATTACCCTAATTAACACGTTGACCCCTTC

Reverse complement sequence

GAAGGGGTCAACGTGTTAATTAGGGTAATACTTCTCCATCCACAAGTAGTAGTCCCCGTCATTAAATAGGTAAGTGAATGTTCTAAATAGATTGGATAAA[T/C]
AGTGGAGGTAGGTGGGAAAGTGAATGGTGGATGGTTATGATTGGTTCGGAAGAGAATGTTGATAGAAAAGTTGTTATATTTTAGGACAAATTCTAAGGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 40.80% 8.15% 5.18% NA
All Indica  2759 45.40% 43.30% 6.42% 4.93% NA
All Japonica  1512 40.10% 43.10% 10.78% 6.08% NA
Aus  269 96.70% 1.10% 1.12% 1.12% NA
Indica I  595 50.90% 46.70% 1.01% 1.34% NA
Indica II  465 12.00% 72.30% 11.40% 4.30% NA
Indica III  913 58.60% 27.10% 6.90% 7.45% NA
Indica Intermediate  786 45.50% 42.40% 7.00% 5.09% NA
Temperate Japonica  767 53.60% 36.80% 5.35% 4.30% NA
Tropical Japonica  504 29.60% 48.60% 14.68% 7.14% NA
Japonica Intermediate  241 19.10% 51.50% 19.92% 9.54% NA
VI/Aromatic  96 14.60% 47.90% 30.21% 7.29% NA
Intermediate  90 42.20% 35.60% 14.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820144025 A -> G LOC_Os08g32520.1 upstream_gene_variant ; 246.0bp to feature; MODIFIER silent_mutation Average:83.978; most accessible tissue: Zhenshan97 root, score: 95.83 N N N N
vg0820144025 A -> G LOC_Os08g32510-LOC_Os08g32520 intergenic_region ; MODIFIER silent_mutation Average:83.978; most accessible tissue: Zhenshan97 root, score: 95.83 N N N N
vg0820144025 A -> DEL N N silent_mutation Average:83.978; most accessible tissue: Zhenshan97 root, score: 95.83 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820144025 A G 0.05 -0.05 -0.06 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820144025 NA 4.12E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 1.70E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 5.36E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 4.02E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 2.58E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 2.50E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 7.04E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 2.59E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 6.28E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 3.59E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 1.69E-06 mr1306_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 3.42E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 7.08E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 3.26E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 6.87E-06 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 3.13E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 9.18E-06 5.09E-08 mr1505_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 3.97E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 1.29E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 2.00E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 3.23E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820144025 NA 7.39E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251