\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820141762:

Variant ID: vg0820141762 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20141762
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.52, C: 0.48, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


GTATTAAAACACTGAGGAAGTACTAAGGCCGTGTTTACTTCCAAAGTTTTTCTTTAAACTTCCGACTTTTTCATCACATCAAAACTTTTCTACACACAAA[T/C]
TTCCAACTTTTTCATCACATCGTTCTAATTTCAACCAAACTTTTAATTTTGGTGTGAATTAAACACAACCTAACTAAAGAAATTTTATACAGTGTACAGG

Reverse complement sequence

CCTGTACACTGTATAAAATTTCTTTAGTTAGGTTGTGTTTAATTCACACCAAAATTAAAAGTTTGGTTGAAATTAGAACGATGTGATGAAAAAGTTGGAA[A/G]
TTTGTGTGTAGAAAAGTTTTGATGTGATGAAAAAGTCGGAAGTTTAAAGAAAAACTTTGGAAGTAAACACGGCCTTAGTACTTCCTCAGTGTTTTAATAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.60% 0.34% 0.00% NA
All Indica  2759 47.80% 51.90% 0.22% 0.00% NA
All Japonica  1512 67.60% 31.90% 0.53% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 50.10% 49.40% 0.50% 0.00% NA
Indica II  465 14.00% 86.00% 0.00% 0.00% NA
Indica III  913 63.30% 36.70% 0.00% 0.00% NA
Indica Intermediate  786 48.20% 51.40% 0.38% 0.00% NA
Temperate Japonica  767 45.00% 54.20% 0.78% 0.00% NA
Tropical Japonica  504 93.50% 6.30% 0.20% 0.00% NA
Japonica Intermediate  241 85.50% 14.10% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820141762 T -> C LOC_Os08g32510.1 upstream_gene_variant ; 4784.0bp to feature; MODIFIER silent_mutation Average:84.429; most accessible tissue: Minghui63 panicle, score: 97.934 N N N N
vg0820141762 T -> C LOC_Os08g32520.1 upstream_gene_variant ; 2509.0bp to feature; MODIFIER silent_mutation Average:84.429; most accessible tissue: Minghui63 panicle, score: 97.934 N N N N
vg0820141762 T -> C LOC_Os08g32510-LOC_Os08g32520 intergenic_region ; MODIFIER silent_mutation Average:84.429; most accessible tissue: Minghui63 panicle, score: 97.934 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820141762 T C 0.01 -0.01 0.0 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820141762 NA 4.99E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 2.16E-16 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 4.42E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 1.34E-06 NA mr1379_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 6.21E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 2.11E-15 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 3.16E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 1.40E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 5.09E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 1.31E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 5.09E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 3.96E-07 NA mr1559_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 3.54E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 6.02E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820141762 NA 1.72E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251