\
| Variant ID: vg0820115562 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20115562 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 101. )
TATAAACATTACGTCTTAAAGTCCGTGCTGCAGCTGGCTACAGATCTGTAGCCCGCTGCTCTTCTCTCACTTCCTTTATCTTTTTAAAATATATTTATAG[T/C]
TGGTTTATAGCTTGCTATTGTGCTTGCTCTTAGTTTGAGAAAATCTCATATGTATTTCTGAAATTTTATTTAATCTCATCTATGCGTTTGAGTTTTAGTT
AACTAAAACTCAAACGCATAGATGAGATTAAATAAAATTTCAGAAATACATATGAGATTTTCTCAAACTAAGAGCAAGCACAATAGCAAGCTATAAACCA[A/G]
CTATAAATATATTTTAAAAAGATAAAGGAAGTGAGAGAAGAGCAGCGGGCTACAGATCTGTAGCCAGCTGCAGCACGGACTTTAAGACGTAATGTTTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 94.70% | 5.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 9.90% | 90.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.90% | 5.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 9.10% | 90.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 38.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820115562 | T -> C | LOC_Os08g32480-LOC_Os08g32490 | intergenic_region ; MODIFIER | silent_mutation | Average:46.912; most accessible tissue: Callus, score: 96.56 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820115562 | NA | 4.45E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0820115562 | NA | 2.28E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 2.01E-14 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 2.25E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 4.68E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 2.06E-29 | mr1256 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 8.17E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 5.74E-16 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 5.71E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | 6.06E-06 | 6.43E-07 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 5.53E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 6.77E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 1.52E-17 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | NA | 8.40E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820115562 | 1.27E-06 | NA | mr1855_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |