Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820093448:

Variant ID: vg0820093448 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20093448
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCCTTTGCTAAATAAATATTATCCCTTATGCCATTCATAATCTAAGCCACACCTAGAATTATCTCTAGAGAGGGAATGCCCCATGTAGACTGAGACCA[C/T]
ACCTCCTATCCCACAGTGCAAAGTTGTTTCAGGAGCGTTTTCAATTTTTCATGTCAAGCCTTACCATCTTCTATTTTAGTCATCATGTGTTTTCATTTTA

Reverse complement sequence

TAAAATGAAAACACATGATGACTAAAATAGAAGATGGTAAGGCTTGACATGAAAAATTGAAAACGCTCCTGAAACAACTTTGCACTGTGGGATAGGAGGT[G/A]
TGGTCTCAGTCTACATGGGGCATTCCCTCTCTAGAGATAATTCTAGGTGTGGCTTAGATTATGAATGGCATAAGGGATAATATTTATTTAGCAAAGGCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	7.50%	1.02%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	74.20%	22.80%	3.04%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	93.40%	3.30%	3.39%	0.00%	NA
Tropical Japonica	504	42.10%	55.80%	2.18%	0.00%	NA
Japonica Intermediate	241	80.50%	15.80%	3.73%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820093448	C -> T	LOC_Os08g32450.1	upstream_gene_variant ; 362.0bp to feature; MODIFIER	silent_mutation	Average:44.053; most accessible tissue: Callus, score: 68.944	N	N	N	N
vg0820093448	C -> T	LOC_Os08g32460.1	upstream_gene_variant ; 2235.0bp to feature; MODIFIER	silent_mutation	Average:44.053; most accessible tissue: Callus, score: 68.944	N	N	N	N
vg0820093448	C -> T	LOC_Os08g32440.1	downstream_gene_variant ; 2583.0bp to feature; MODIFIER	silent_mutation	Average:44.053; most accessible tissue: Callus, score: 68.944	N	N	N	N
vg0820093448	C -> T	LOC_Os08g32440-LOC_Os08g32450	intergenic_region ; MODIFIER	silent_mutation	Average:44.053; most accessible tissue: Callus, score: 68.944	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820093448	NA	1.95E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	1.18E-10	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	3.22E-07	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	1.10E-19	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	5.01E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	2.71E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	1.79E-11	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	1.62E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	9.34E-29	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	1.28E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	6.94E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	1.86E-06	NA	mr1233_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	2.08E-20	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	1.96E-08	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	2.31E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	8.76E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	5.09E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	1.67E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448	NA	2.21E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251