\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820093448:

Variant ID: vg0820093448 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20093448
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCCTTTGCTAAATAAATATTATCCCTTATGCCATTCATAATCTAAGCCACACCTAGAATTATCTCTAGAGAGGGAATGCCCCATGTAGACTGAGACCA[C/T]
ACCTCCTATCCCACAGTGCAAAGTTGTTTCAGGAGCGTTTTCAATTTTTCATGTCAAGCCTTACCATCTTCTATTTTAGTCATCATGTGTTTTCATTTTA

Reverse complement sequence

TAAAATGAAAACACATGATGACTAAAATAGAAGATGGTAAGGCTTGACATGAAAAATTGAAAACGCTCCTGAAACAACTTTGCACTGTGGGATAGGAGGT[G/A]
TGGTCTCAGTCTACATGGGGCATTCCCTCTCTAGAGATAATTCTAGGTGTGGCTTAGATTATGAATGGCATAAGGGATAATATTTATTTAGCAAAGGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 7.50% 1.02% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 74.20% 22.80% 3.04% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 93.40% 3.30% 3.39% 0.00% NA
Tropical Japonica  504 42.10% 55.80% 2.18% 0.00% NA
Japonica Intermediate  241 80.50% 15.80% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820093448 C -> T LOC_Os08g32450.1 upstream_gene_variant ; 362.0bp to feature; MODIFIER silent_mutation Average:44.053; most accessible tissue: Callus, score: 68.944 N N N N
vg0820093448 C -> T LOC_Os08g32460.1 upstream_gene_variant ; 2235.0bp to feature; MODIFIER silent_mutation Average:44.053; most accessible tissue: Callus, score: 68.944 N N N N
vg0820093448 C -> T LOC_Os08g32440.1 downstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:44.053; most accessible tissue: Callus, score: 68.944 N N N N
vg0820093448 C -> T LOC_Os08g32440-LOC_Os08g32450 intergenic_region ; MODIFIER silent_mutation Average:44.053; most accessible tissue: Callus, score: 68.944 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820093448 NA 1.95E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 1.18E-10 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 3.22E-07 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 1.10E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 5.01E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 2.71E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 1.79E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 1.62E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 9.34E-29 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 1.28E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 6.94E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 1.86E-06 NA mr1233_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 2.08E-20 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 1.96E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 2.31E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 8.76E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 5.09E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 1.67E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820093448 NA 2.21E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251