\
| Variant ID: vg0820072079 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20072079 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCTTAGAAAGGAGAGAGAGAGAAAAACATTAGGCACCTAACTATAGTAGGGGACGGGGGTGAGCAGTGTCGAGGAATTGACTGAGGAAAGCATCACATA[T/C]
GCAGGATTAAAATTGGACACTTGAGCTGTTTATTTATGGGCCAATTGTGAATTGGATGTGGTGGTAAGCGGCCCAAAAAGGATATGGAGGTTTGGGGCGG
CCGCCCCAAACCTCCATATCCTTTTTGGGCCGCTTACCACCACATCCAATTCACAATTGGCCCATAAATAAACAGCTCAAGTGTCCAATTTTAATCCTGC[A/G]
TATGTGATGCTTTCCTCAGTCAATTCCTCGACACTGCTCACCCCCGTCCCCTACTATAGTTAGGTGCCTAATGTTTTTCTCTCTCTCTCCTTTCTAAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.40% | 0.04% | 0.42% | NA |
| All Indica | 2759 | 98.60% | 0.90% | 0.04% | 0.47% | NA |
| All Japonica | 1512 | 11.00% | 88.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.10% | 0.00% | 0.88% | NA |
| Indica Intermediate | 786 | 97.80% | 1.40% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 25.20% | 74.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 34.40% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820072079 | T -> C | LOC_Os08g32410.1 | upstream_gene_variant ; 1302.0bp to feature; MODIFIER | silent_mutation | Average:52.48; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0820072079 | T -> C | LOC_Os08g32400.1 | downstream_gene_variant ; 3569.0bp to feature; MODIFIER | silent_mutation | Average:52.48; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0820072079 | T -> C | LOC_Os08g32400-LOC_Os08g32410 | intergenic_region ; MODIFIER | silent_mutation | Average:52.48; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0820072079 | T -> DEL | N | N | silent_mutation | Average:52.48; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820072079 | NA | 1.01E-55 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0820072079 | NA | 5.05E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 2.88E-33 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 2.38E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 9.01E-17 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.29E-25 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 5.61E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 3.53E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.22E-27 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 3.70E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 7.82E-31 | mr1256 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 4.55E-10 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 2.10E-16 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.68E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.29E-16 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 8.09E-38 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.70E-15 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 3.28E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.38E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 7.54E-28 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.03E-07 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.40E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 9.40E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | 4.67E-06 | 1.28E-43 | mr1601 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | 9.75E-06 | 9.75E-06 | mr1601 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 2.40E-20 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 2.37E-13 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 7.98E-30 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 3.03E-14 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 6.08E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 4.45E-09 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | 6.45E-07 | 6.45E-07 | mr1659 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 2.81E-82 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.65E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 3.34E-59 | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 6.09E-22 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 4.48E-60 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 4.25E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 8.02E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 8.02E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.29E-16 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.63E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 2.00E-22 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 3.37E-15 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 9.22E-24 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.31E-12 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.11E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | 8.54E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | 7.22E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | 2.15E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | 5.42E-06 | 1.38E-36 | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 4.60E-55 | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 7.48E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | 3.24E-06 | 5.09E-07 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | 1.42E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.92E-24 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 2.15E-58 | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 8.90E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 4.22E-51 | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 7.72E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 2.53E-36 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 8.46E-06 | mr1620_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 6.55E-29 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.90E-24 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820072079 | NA | 1.56E-32 | mr1780_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |