\
| Variant ID: vg0820068882 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20068882 |
| Reference Allele: C | Alternative Allele: T,A,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.00, others allele: 0.00, population size: 245. )
GTAGGCATGTTATCATTTCATTTGGTCAGAATTAGACGTGTGTACCTGAAAATCAAATCAGATCACTATTTGTTATTATTAAGTTGCATGCACCGACCAG[C/T,A,G]
TCAACCCAAAAGCCTAAGCTGATAGGAAAAGGCGGGCAATTCACTTTATACACTCCAACACTCCCCCTCACGCGAGACCCCCTCAAGTCTCAAGCGTGGA
TCCACGCTTGAGACTTGAGGGGGTCTCGCGTGAGGGGGAGTGTTGGAGTGTATAAAGTGAATTGCCCGCCTTTTCCTATCAGCTTAGGCTTTTGGGTTGA[G/A,T,C]
CTGGTCGGTGCATGCAACTTAATAATAACAAATAGTGATCTGATTTGATTTTCAGGTACACACGTCTAATTCTGACCAAATGAAATGATAACATGCCTAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.70% | 30.50% | 0.83% | 0.91% | A: 0.08% |
| All Indica | 2759 | 97.40% | 1.00% | 0.80% | 0.72% | A: 0.11% |
| All Japonica | 1512 | 11.00% | 88.80% | 0.07% | 0.13% | NA |
| Aus | 269 | 87.40% | 1.10% | 3.35% | 7.81% | A: 0.37% |
| Indica I | 595 | 95.50% | 1.30% | 0.84% | 2.35% | NA |
| Indica II | 465 | 98.30% | 1.10% | 0.43% | 0.22% | NA |
| Indica III | 913 | 98.70% | 0.10% | 0.77% | 0.11% | A: 0.33% |
| Indica Intermediate | 786 | 96.70% | 1.80% | 1.02% | 0.51% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 25.40% | 74.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 12.90% | 87.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 34.40% | 6.25% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 40.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820068882 | C -> G | LOC_Os08g32410.1 | upstream_gene_variant ; 4499.0bp to feature; MODIFIER | N | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0820068882 | C -> G | LOC_Os08g32400.1 | downstream_gene_variant ; 372.0bp to feature; MODIFIER | N | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0820068882 | C -> G | LOC_Os08g32400-LOC_Os08g32410 | intergenic_region ; MODIFIER | N | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0820068882 | C -> T | LOC_Os08g32410.1 | upstream_gene_variant ; 4499.0bp to feature; MODIFIER | silent_mutation | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0820068882 | C -> T | LOC_Os08g32400.1 | downstream_gene_variant ; 372.0bp to feature; MODIFIER | silent_mutation | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0820068882 | C -> T | LOC_Os08g32400-LOC_Os08g32410 | intergenic_region ; MODIFIER | silent_mutation | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0820068882 | C -> A | LOC_Os08g32410.1 | upstream_gene_variant ; 4499.0bp to feature; MODIFIER | silent_mutation | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0820068882 | C -> A | LOC_Os08g32400.1 | downstream_gene_variant ; 372.0bp to feature; MODIFIER | silent_mutation | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0820068882 | C -> A | LOC_Os08g32400-LOC_Os08g32410 | intergenic_region ; MODIFIER | silent_mutation | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0820068882 | C -> DEL | N | N | silent_mutation | Average:49.863; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820068882 | NA | 7.85E-54 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0820068882 | NA | 8.47E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 2.49E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 7.35E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 2.20E-42 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 4.00E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.68E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.69E-27 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 5.96E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.66E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.26E-29 | mr1256 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.65E-10 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 2.78E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.31E-17 | mr1304 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.12E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 2.19E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.29E-15 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 9.75E-38 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.14E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.18E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 4.88E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 9.48E-29 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.18E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.31E-07 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.90E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 8.75E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.26E-39 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.32E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 6.17E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 5.41E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | 1.71E-06 | 4.40E-44 | mr1601 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | 2.30E-06 | 2.29E-06 | mr1601 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 7.23E-21 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.55E-13 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.48E-29 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.80E-14 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 8.56E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.02E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 4.10E-12 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 6.47E-22 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.85E-62 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.19E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 6.44E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 6.44E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.21E-17 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 6.03E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.80E-21 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.21E-12 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 5.03E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 4.51E-16 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 6.56E-13 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 6.44E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | 5.94E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | 4.38E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | 5.31E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 2.62E-53 | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.46E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | 2.50E-07 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 2.64E-24 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 1.11E-23 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 3.01E-50 | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 2.94E-36 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 4.59E-23 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820068882 | NA | 4.53E-11 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |