Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820065663:

Variant ID: vg0820065663 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20065663
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCTTATTTGAAATTTTTTTATGATTACTATTTTTATTTTTATTAGATGATAAAACATGAATAGTATTTTTATATGTGATTCATTTTTTAAAAAATTTT[C/T]
ATAATTTTTTCAACTAAGACGAACGGTCAAACGCTGGATATGATATCCATGACTGCATTTATCTTGGGACGGAGGTAATTTCTTCGTTTCATATTATAAG

Reverse complement sequence

CTTATAATATGAAACGAAGAAATTACCTCCGTCCCAAGATAAATGCAGTCATGGATATCATATCCAGCGTTTGACCGTTCGTCTTAGTTGAAAAAATTAT[G/A]
AAAATTTTTTAAAAAATGAATCACATATAAAAATACTATTCATGTTTTATCATCTAATAAAAATAAAAATAGTAATCATAAAAAAATTTCAAATAAGATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.30%	30.20%	0.47%	0.00%	NA
All Indica	2759	65.60%	33.80%	0.58%	0.00%	NA
All Japonica	1512	89.40%	10.60%	0.00%	0.00%	NA
Aus	269	4.50%	95.20%	0.37%	0.00%	NA
Indica I	595	54.30%	45.40%	0.34%	0.00%	NA
Indica II	465	88.60%	11.40%	0.00%	0.00%	NA
Indica III	913	60.40%	38.80%	0.88%	0.00%	NA
Indica Intermediate	786	66.80%	32.40%	0.76%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	74.80%	25.20%	0.00%	0.00%	NA
Japonica Intermediate	241	88.00%	12.00%	0.00%	0.00%	NA
VI/Aromatic	96	41.70%	53.10%	5.21%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820065663	C -> T	LOC_Os08g32400.1	upstream_gene_variant ; 444.0bp to feature; MODIFIER	silent_mutation	Average:50.096; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0820065663	C -> T	LOC_Os08g32390.1	downstream_gene_variant ; 3914.0bp to feature; MODIFIER	silent_mutation	Average:50.096; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0820065663	C -> T	LOC_Os08g32390-LOC_Os08g32400	intergenic_region ; MODIFIER	silent_mutation	Average:50.096; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820065663	NA	4.77E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	2.57E-06	2.57E-06	mr1601	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	NA	1.08E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	3.69E-06	NA	mr1070_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	7.22E-07	2.33E-06	mr1085_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	2.69E-06	7.96E-07	mr1088_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	2.98E-07	9.96E-08	mr1103_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	5.01E-09	1.01E-10	mr1224_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	8.88E-06	NA	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	4.99E-07	4.99E-07	mr1233_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	7.79E-07	NA	mr1241_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	NA	4.72E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	2.72E-07	1.65E-09	mr1404_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	1.19E-06	1.23E-06	mr1437_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	2.18E-06	1.12E-08	mr1620_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820065663	1.42E-06	1.34E-06	mr1949_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251