\
| Variant ID: vg0820033637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20033637 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGATGTCGGAAGGAGTTTTGAACACGAATGAAAAAACTATTTTCATAACTTGTCTGGAAACCGCGAGACGAACTTATTAAGCCTAGTTAATCCATCATTA[G/A]
CACATATGGGTTACTGTAGTACTTATAGCTAATCATGGACTAATTAGGCTCAAAAGATTCGTCTCGCGATTTCCATGCAAACTGTTAAATTAGTTTTTTT
AAAAAAACTAATTTAACAGTTTGCATGGAAATCGCGAGACGAATCTTTTGAGCCTAATTAGTCCATGATTAGCTATAAGTACTACAGTAACCCATATGTG[C/T]
TAATGATGGATTAACTAGGCTTAATAAGTTCGTCTCGCGGTTTCCAGACAAGTTATGAAAATAGTTTTTTCATTCGTGTTCAAAACTCCTTCCGACATCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 11.90% | 0.32% | 4.63% | NA |
| All Indica | 2759 | 73.40% | 19.00% | 0.51% | 7.14% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.07% | NA |
| Aus | 269 | 85.90% | 11.90% | 0.00% | 2.23% | NA |
| Indica I | 595 | 82.00% | 18.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.20% | 3.20% | 0.86% | 7.74% | NA |
| Indica III | 913 | 60.10% | 27.50% | 0.66% | 11.72% | NA |
| Indica Intermediate | 786 | 73.50% | 19.10% | 0.51% | 6.87% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 85.60% | 8.90% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820033637 | G -> A | LOC_Os08g32350.1 | downstream_gene_variant ; 466.0bp to feature; MODIFIER | silent_mutation | Average:19.742; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0820033637 | G -> A | LOC_Os08g32350.2 | intron_variant ; MODIFIER | silent_mutation | Average:19.742; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0820033637 | G -> DEL | N | N | silent_mutation | Average:19.742; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820033637 | NA | 7.24E-07 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820033637 | 3.81E-06 | 3.81E-06 | mr1717 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820033637 | NA | 6.82E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820033637 | NA | 3.93E-06 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820033637 | NA | 5.41E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820033637 | 7.44E-06 | 6.37E-09 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820033637 | NA | 8.90E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820033637 | NA | 2.44E-06 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820033637 | NA | 3.07E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |