| Variant ID: vg0820029453 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20029453 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACGGTTCAAAAAATGTTATATAGAAAAATGATCAAAATAAAAGTTATAGATCTTGATGAGTTATACAACTTTGTTGTTGATGAATTTTTCAGTTGAAGT[C/T]
GTTCACTGATCTAAAATTCTATTTGAACTTTTCAAACTTTGAATTTCAAATTTCAAATTGTTTAAATAGAGTTAGATGGAGAAATGACAAAAATAAAAAT
ATTTTTATTTTTGTCATTTCTCCATCTAACTCTATTTAAACAATTTGAAATTTGAAATTCAAAGTTTGAAAAGTTCAAATAGAATTTTAGATCAGTGAAC[G/A]
ACTTCAACTGAAAAATTCATCAACAACAAAGTTGTATAACTCATCAAGATCTATAACTTTTATTTTGATCATTTTTCTATATAACATTTTTTGAACCGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.60% | 7.00% | 0.66% | 12.78% | NA |
| All Indica | 2759 | 67.30% | 10.80% | 1.09% | 20.84% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Aus | 269 | 85.90% | 11.20% | 0.00% | 2.97% | NA |
| Indica I | 595 | 81.30% | 16.00% | 0.00% | 2.69% | NA |
| Indica II | 465 | 86.70% | 0.20% | 0.43% | 12.69% | NA |
| Indica III | 913 | 46.70% | 15.10% | 1.75% | 36.47% | NA |
| Indica Intermediate | 786 | 69.20% | 8.00% | 1.53% | 21.25% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 1.04% | 10.42% | NA |
| Intermediate | 90 | 85.60% | 4.40% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820029453 | C -> T | LOC_Os08g32350.1 | upstream_gene_variant ; 2644.0bp to feature; MODIFIER | silent_mutation | Average:11.42; most accessible tissue: Callus, score: 32.935 | N | N | N | N |
| vg0820029453 | C -> T | LOC_Os08g32350.2 | upstream_gene_variant ; 2644.0bp to feature; MODIFIER | silent_mutation | Average:11.42; most accessible tissue: Callus, score: 32.935 | N | N | N | N |
| vg0820029453 | C -> T | LOC_Os08g32340.1 | downstream_gene_variant ; 2556.0bp to feature; MODIFIER | silent_mutation | Average:11.42; most accessible tissue: Callus, score: 32.935 | N | N | N | N |
| vg0820029453 | C -> T | LOC_Os08g32340-LOC_Os08g32350 | intergenic_region ; MODIFIER | silent_mutation | Average:11.42; most accessible tissue: Callus, score: 32.935 | N | N | N | N |
| vg0820029453 | C -> DEL | N | N | silent_mutation | Average:11.42; most accessible tissue: Callus, score: 32.935 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820029453 | 7.11E-06 | NA | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820029453 | 1.87E-06 | NA | mr1707_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820029453 | 4.47E-06 | NA | mr1860_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820029453 | 9.54E-07 | 5.11E-07 | mr1860_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |