\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820029176:

Variant ID: vg0820029176 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20029176
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAAACTTTTATTTTTGTTATTTCTTCATCCGACGAAATGTTAGTAATATTATTCACAAATTTTACATATATGTGTTATAGTTTATAAAACCAGATAAGA[T/G]
ATATATCAATTTTGTGAACAATGTTACTATCATTTTGTCGTATAAAGAAATGACCAAAATAAAAGTTTTAGATCTTGATAAGTTATTCAACTTTGTTGTT

Reverse complement sequence

AACAACAAAGTTGAATAACTTATCAAGATCTAAAACTTTTATTTTGGTCATTTCTTTATACGACAAAATGATAGTAACATTGTTCACAAAATTGATATAT[A/C]
TCTTATCTGGTTTTATAAACTATAACACATATATGTAAAATTTGTGAATAATATTACTAACATTTCGTCGGATGAAGAAATAACAAAAATAAAAGTTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 14.70% 3.96% 21.03% NA
All Indica  2759 61.70% 0.70% 5.62% 32.00% NA
All Japonica  1512 49.80% 42.70% 1.98% 5.49% NA
Aus  269 96.70% 0.40% 0.00% 2.97% NA
Indica I  595 68.40% 0.70% 8.74% 22.18% NA
Indica II  465 77.00% 1.10% 3.87% 18.06% NA
Indica III  913 47.80% 0.10% 6.24% 45.89% NA
Indica Intermediate  786 63.70% 1.10% 3.56% 31.55% NA
Temperate Japonica  767 37.40% 62.30% 0.13% 0.13% NA
Tropical Japonica  504 72.00% 9.10% 4.96% 13.89% NA
Japonica Intermediate  241 42.70% 50.60% 1.66% 4.98% NA
VI/Aromatic  96 83.30% 5.20% 0.00% 11.46% NA
Intermediate  90 63.30% 24.40% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820029176 T -> G LOC_Os08g32350.1 upstream_gene_variant ; 2921.0bp to feature; MODIFIER silent_mutation Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0820029176 T -> G LOC_Os08g32350.2 upstream_gene_variant ; 2921.0bp to feature; MODIFIER silent_mutation Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0820029176 T -> G LOC_Os08g32340.1 downstream_gene_variant ; 2279.0bp to feature; MODIFIER silent_mutation Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0820029176 T -> G LOC_Os08g32340-LOC_Os08g32350 intergenic_region ; MODIFIER silent_mutation Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0820029176 T -> DEL N N silent_mutation Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820029176 NA 2.07E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.04E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 5.58E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 6.35E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 5.32E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.35E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 5.51E-11 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 8.93E-06 1.12E-24 mr1805 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 9.57E-08 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 5.00E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.27E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 6.21E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 2.75E-06 2.75E-06 mr1207_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 5.76E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.78E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.39E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 7.07E-07 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.10E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 3.48E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.44E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.99E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.16E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 1.69E-07 NA mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 7.15E-06 2.37E-11 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.35E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 6.88E-09 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 3.57E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 5.01E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 2.25E-06 5.00E-11 mr1681_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.17E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 3.11E-06 NA mr1849_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.61E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.12E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.10E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 4.83E-06 mr1924_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 3.29E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 2.75E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176 NA 1.17E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251