Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820029176:

Variant ID: vg0820029176 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20029176
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAACTTTTATTTTTGTTATTTCTTCATCCGACGAAATGTTAGTAATATTATTCACAAATTTTACATATATGTGTTATAGTTTATAAAACCAGATAAGA[T/G]
ATATATCAATTTTGTGAACAATGTTACTATCATTTTGTCGTATAAAGAAATGACCAAAATAAAAGTTTTAGATCTTGATAAGTTATTCAACTTTGTTGTT

Reverse complement sequence

AACAACAAAGTTGAATAACTTATCAAGATCTAAAACTTTTATTTTGGTCATTTCTTTATACGACAAAATGATAGTAACATTGTTCACAAAATTGATATAT[A/C]
TCTTATCTGGTTTTATAAACTATAACACATATATGTAAAATTTGTGAATAATATTACTAACATTTCGTCGGATGAAGAAATAACAAAAATAAAAGTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	14.70%	3.96%	21.03%	NA
All Indica	2759	61.70%	0.70%	5.62%	32.00%	NA
All Japonica	1512	49.80%	42.70%	1.98%	5.49%	NA
Aus	269	96.70%	0.40%	0.00%	2.97%	NA
Indica I	595	68.40%	0.70%	8.74%	22.18%	NA
Indica II	465	77.00%	1.10%	3.87%	18.06%	NA
Indica III	913	47.80%	0.10%	6.24%	45.89%	NA
Indica Intermediate	786	63.70%	1.10%	3.56%	31.55%	NA
Temperate Japonica	767	37.40%	62.30%	0.13%	0.13%	NA
Tropical Japonica	504	72.00%	9.10%	4.96%	13.89%	NA
Japonica Intermediate	241	42.70%	50.60%	1.66%	4.98%	NA
VI/Aromatic	96	83.30%	5.20%	0.00%	11.46%	NA
Intermediate	90	63.30%	24.40%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820029176	T -> G	LOC_Os08g32350.1	upstream_gene_variant ; 2921.0bp to feature; MODIFIER	silent_mutation	Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0820029176	T -> G	LOC_Os08g32350.2	upstream_gene_variant ; 2921.0bp to feature; MODIFIER	silent_mutation	Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0820029176	T -> G	LOC_Os08g32340.1	downstream_gene_variant ; 2279.0bp to feature; MODIFIER	silent_mutation	Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0820029176	T -> G	LOC_Os08g32340-LOC_Os08g32350	intergenic_region ; MODIFIER	silent_mutation	Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0820029176	T -> DEL	N	N	silent_mutation	Average:8.727; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820029176	NA	2.07E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.04E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	5.58E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	6.35E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	5.32E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.35E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	5.51E-11	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	8.93E-06	1.12E-24	mr1805	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	9.57E-08	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	5.00E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.27E-14	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	6.21E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	2.75E-06	2.75E-06	mr1207_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	5.76E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.78E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.39E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	7.07E-07	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.10E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	3.48E-12	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.44E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.99E-07	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.16E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	1.69E-07	NA	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	7.15E-06	2.37E-11	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.35E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	6.88E-09	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	3.57E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	5.01E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	2.25E-06	5.00E-11	mr1681_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.17E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	3.11E-06	NA	mr1849_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.61E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.12E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.10E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	4.83E-06	mr1924_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	3.29E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	2.75E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820029176	NA	1.17E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251