\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819998404:

Variant ID: vg0819998404 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19998404
Reference Allele: CAlternative Allele: G,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATTGTAAATAATGGGTCCACCAAATTAGTTGAAATATGTTTTGTTTTTTAGAATTATTAAGAATTTTACTAATTTATTAGAGCATCACATGGTAACTT[C/G,A]
GAATCGTTTGTAGCATGTCATCTGGTGGATTAGGAGTATTTTTACGAAGTTTAATGGACTTTTAGTATATAATGGATACATATAATCTGATGTTCTAAAA

Reverse complement sequence

TTTTAGAACATCAGATTATATGTATCCATTATATACTAAAAGTCCATTAAACTTCGTAAAAATACTCCTAATCCACCAGATGACATGCTACAAACGATTC[G/C,T]
AAGTTACCATGTGATGCTCTAATAAATTAGTAAAATTCTTAATAATTCTAAAAAACAAAACATATTTCAACTAATTTGGTGGACCCATTATTTACAATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 13.50% 8.51% 12.55% A: 2.18%
All Indica  2759 73.00% 1.10% 11.02% 11.56% A: 3.33%
All Japonica  1512 47.80% 38.80% 3.17% 10.19% NA
Aus  269 55.40% 0.70% 11.90% 30.86% A: 1.12%
Indica I  595 69.70% 1.50% 12.10% 15.97% A: 0.67%
Indica II  465 77.60% 1.50% 13.12% 7.31% A: 0.43%
Indica III  913 75.20% 0.10% 9.09% 9.64% A: 5.91%
Indica Intermediate  786 70.20% 1.50% 11.20% 12.98% A: 4.07%
Temperate Japonica  767 34.30% 56.30% 2.74% 6.65% NA
Tropical Japonica  504 72.40% 8.30% 4.17% 15.08% NA
Japonica Intermediate  241 39.40% 46.90% 2.49% 11.20% NA
VI/Aromatic  96 51.00% 4.20% 11.46% 27.08% A: 6.25%
Intermediate  90 57.80% 20.00% 7.78% 12.22% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819998404 C -> G LOC_Os08g32270.1 upstream_gene_variant ; 2830.0bp to feature; MODIFIER silent_mutation Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0819998404 C -> G LOC_Os08g32280.1 downstream_gene_variant ; 2618.0bp to feature; MODIFIER silent_mutation Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0819998404 C -> G LOC_Os08g32270-LOC_Os08g32280 intergenic_region ; MODIFIER silent_mutation Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0819998404 C -> A LOC_Os08g32270.1 upstream_gene_variant ; 2830.0bp to feature; MODIFIER silent_mutation Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0819998404 C -> A LOC_Os08g32280.1 downstream_gene_variant ; 2618.0bp to feature; MODIFIER silent_mutation Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0819998404 C -> A LOC_Os08g32270-LOC_Os08g32280 intergenic_region ; MODIFIER silent_mutation Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0819998404 C -> DEL N N silent_mutation Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819998404 NA 5.86E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 9.42E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 1.32E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 2.99E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 4.48E-06 4.47E-06 mr1207_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 7.03E-06 mr1209_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 4.57E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 1.51E-06 9.81E-13 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 5.66E-07 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 6.49E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 1.92E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 7.33E-09 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 1.89E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 5.51E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 9.88E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 5.37E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 1.51E-07 NA mr1551_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 9.45E-06 3.03E-11 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 4.12E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 3.04E-09 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 6.24E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 1.11E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 4.74E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 4.09E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 9.23E-06 NA mr1849_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 1.79E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 5.27E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 6.24E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 4.99E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 7.40E-06 NA mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 4.78E-19 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404 NA 4.64E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251