Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0819998404:

Variant ID: vg0819998404 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19998404
Reference Allele: C	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGATTGTAAATAATGGGTCCACCAAATTAGTTGAAATATGTTTTGTTTTTTAGAATTATTAAGAATTTTACTAATTTATTAGAGCATCACATGGTAACTT[C/G,A]
GAATCGTTTGTAGCATGTCATCTGGTGGATTAGGAGTATTTTTACGAAGTTTAATGGACTTTTAGTATATAATGGATACATATAATCTGATGTTCTAAAA

Reverse complement sequence

TTTTAGAACATCAGATTATATGTATCCATTATATACTAAAAGTCCATTAAACTTCGTAAAAATACTCCTAATCCACCAGATGACATGCTACAAACGATTC[G/C,T]
AAGTTACCATGTGATGCTCTAATAAATTAGTAAAATTCTTAATAATTCTAAAAAACAAAACATATTTCAACTAATTTGGTGGACCCATTATTTACAATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	13.50%	8.51%	12.55%	A: 2.18%
All Indica	2759	73.00%	1.10%	11.02%	11.56%	A: 3.33%
All Japonica	1512	47.80%	38.80%	3.17%	10.19%	NA
Aus	269	55.40%	0.70%	11.90%	30.86%	A: 1.12%
Indica I	595	69.70%	1.50%	12.10%	15.97%	A: 0.67%
Indica II	465	77.60%	1.50%	13.12%	7.31%	A: 0.43%
Indica III	913	75.20%	0.10%	9.09%	9.64%	A: 5.91%
Indica Intermediate	786	70.20%	1.50%	11.20%	12.98%	A: 4.07%
Temperate Japonica	767	34.30%	56.30%	2.74%	6.65%	NA
Tropical Japonica	504	72.40%	8.30%	4.17%	15.08%	NA
Japonica Intermediate	241	39.40%	46.90%	2.49%	11.20%	NA
VI/Aromatic	96	51.00%	4.20%	11.46%	27.08%	A: 6.25%
Intermediate	90	57.80%	20.00%	7.78%	12.22%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819998404	C -> G	LOC_Os08g32270.1	upstream_gene_variant ; 2830.0bp to feature; MODIFIER	silent_mutation	Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0819998404	C -> G	LOC_Os08g32280.1	downstream_gene_variant ; 2618.0bp to feature; MODIFIER	silent_mutation	Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0819998404	C -> G	LOC_Os08g32270-LOC_Os08g32280	intergenic_region ; MODIFIER	silent_mutation	Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0819998404	C -> A	LOC_Os08g32270.1	upstream_gene_variant ; 2830.0bp to feature; MODIFIER	silent_mutation	Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0819998404	C -> A	LOC_Os08g32280.1	downstream_gene_variant ; 2618.0bp to feature; MODIFIER	silent_mutation	Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0819998404	C -> A	LOC_Os08g32270-LOC_Os08g32280	intergenic_region ; MODIFIER	silent_mutation	Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0819998404	C -> DEL	N	N	silent_mutation	Average:46.931; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819998404	NA	5.86E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	9.42E-06	mr1632	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	1.32E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	2.99E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	4.48E-06	4.47E-06	mr1207_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	7.03E-06	mr1209_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	4.57E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	1.51E-06	9.81E-13	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	5.66E-07	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	6.49E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	1.92E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	7.33E-09	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	1.89E-07	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	5.51E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	9.88E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	5.37E-09	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	1.51E-07	NA	mr1551_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	9.45E-06	3.03E-11	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	4.12E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	3.04E-09	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	6.24E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	1.11E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	4.74E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	4.09E-12	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	9.23E-06	NA	mr1849_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	1.79E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	5.27E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	6.24E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	4.99E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	7.40E-06	NA	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	4.78E-19	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819998404	NA	4.64E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251