Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819989626:

Variant ID: vg0819989626 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19989626
Reference Allele: T	Alternative Allele: G,A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

CCATATTGACAGGAAAAGGATTGCCATCAACCTTCATCGTCCTCTTGGAATCATCAAATTTGATTTTGCCTCCTTCGATAGCCATTTGGATCTGCTGCCT[T/G,A]
AAGACCTTGCAATCATTGGTAGTATGAGATCCAGAATTGTGCCATTTGCAATACCTTTTCTTGCCTAATTCCTCAGCCGATGGAATAGTATGACCAGCAG

Reverse complement sequence

CTGCTGGTCATACTATTCCATCGGCTGAGGAATTAGGCAAGAAAAGGTATTGCAAATGGCACAATTCTGGATCTCATACTACCAATGATTGCAAGGTCTT[A/C,T]
AGGCAGCAGATCCAAATGGCTATCGAAGGAGGCAAAATCAAATTTGATGATTCCAAGAGGACGATGAAGGTTGATGGCAATCCTTTTCCTGTCAATATGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.80%	32.70%	11.34%	14.94%	G: 0.19%
All Indica	2759	66.40%	3.60%	17.62%	12.40%	G: 0.04%
All Japonica	1512	3.20%	90.80%	0.79%	5.09%	G: 0.07%
Aus	269	7.80%	2.20%	4.83%	85.13%	NA
Indica I	595	24.00%	6.20%	37.65%	32.10%	NA
Indica II	465	83.40%	3.40%	9.46%	3.66%	NA
Indica III	913	85.40%	0.80%	9.31%	4.38%	G: 0.11%
Indica Intermediate	786	66.20%	5.00%	16.92%	11.96%	NA
Temperate Japonica	767	0.30%	99.10%	0.39%	0.26%	NA
Tropical Japonica	504	8.50%	79.20%	1.19%	11.11%	NA
Japonica Intermediate	241	1.70%	88.80%	1.24%	7.88%	G: 0.41%
VI/Aromatic	96	8.30%	29.20%	11.46%	44.79%	G: 6.25%
Intermediate	90	21.10%	45.60%	15.56%	16.67%	G: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819989626	T -> G	LOC_Os08g32260.1	missense_variant ; p.Leu484Phe; MODERATE	nonsynonymous_codon ; L484F	Average:8.17; most accessible tissue: Callus, score: 14.767	benign	-0.49	TOLERATED	1.00
vg0819989626	T -> A	LOC_Os08g32260.1	missense_variant ; p.Leu484Phe; MODERATE	nonsynonymous_codon ; L484F	Average:8.17; most accessible tissue: Callus, score: 14.767	benign	-0.49	TOLERATED	1.00
vg0819989626	T -> DEL	LOC_Os08g32260.1	N	frameshift_variant	Average:8.17; most accessible tissue: Callus, score: 14.767	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819989626	NA	1.02E-25	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.38E-67	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	4.75E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	2.62E-35	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	3.34E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	9.55E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	3.34E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	6.82E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	9.37E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	6.77E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	1.79E-06	5.10E-25	mr1627	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	4.54E-13	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	5.09E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	5.87E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.20E-10	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.01E-18	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.26E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.04E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	4.47E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	6.40E-23	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.00E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.45E-37	mr1882	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.17E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.02E-08	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.84E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	NA	1.30E-22	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626	6.16E-06	8.63E-28	mr1708_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251