\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819989626:

Variant ID: vg0819989626 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19989626
Reference Allele: TAlternative Allele: G,A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


CCATATTGACAGGAAAAGGATTGCCATCAACCTTCATCGTCCTCTTGGAATCATCAAATTTGATTTTGCCTCCTTCGATAGCCATTTGGATCTGCTGCCT[T/G,A]
AAGACCTTGCAATCATTGGTAGTATGAGATCCAGAATTGTGCCATTTGCAATACCTTTTCTTGCCTAATTCCTCAGCCGATGGAATAGTATGACCAGCAG

Reverse complement sequence

CTGCTGGTCATACTATTCCATCGGCTGAGGAATTAGGCAAGAAAAGGTATTGCAAATGGCACAATTCTGGATCTCATACTACCAATGATTGCAAGGTCTT[A/C,T]
AGGCAGCAGATCCAAATGGCTATCGAAGGAGGCAAAATCAAATTTGATGATTCCAAGAGGACGATGAAGGTTGATGGCAATCCTTTTCCTGTCAATATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.80% 32.70% 11.34% 14.94% G: 0.19%
All Indica  2759 66.40% 3.60% 17.62% 12.40% G: 0.04%
All Japonica  1512 3.20% 90.80% 0.79% 5.09% G: 0.07%
Aus  269 7.80% 2.20% 4.83% 85.13% NA
Indica I  595 24.00% 6.20% 37.65% 32.10% NA
Indica II  465 83.40% 3.40% 9.46% 3.66% NA
Indica III  913 85.40% 0.80% 9.31% 4.38% G: 0.11%
Indica Intermediate  786 66.20% 5.00% 16.92% 11.96% NA
Temperate Japonica  767 0.30% 99.10% 0.39% 0.26% NA
Tropical Japonica  504 8.50% 79.20% 1.19% 11.11% NA
Japonica Intermediate  241 1.70% 88.80% 1.24% 7.88% G: 0.41%
VI/Aromatic  96 8.30% 29.20% 11.46% 44.79% G: 6.25%
Intermediate  90 21.10% 45.60% 15.56% 16.67% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819989626 T -> G LOC_Os08g32260.1 missense_variant ; p.Leu484Phe; MODERATE nonsynonymous_codon ; L484F Average:8.17; most accessible tissue: Callus, score: 14.767 benign -0.49 TOLERATED 1.00
vg0819989626 T -> A LOC_Os08g32260.1 missense_variant ; p.Leu484Phe; MODERATE nonsynonymous_codon ; L484F Average:8.17; most accessible tissue: Callus, score: 14.767 benign -0.49 TOLERATED 1.00
vg0819989626 T -> DEL LOC_Os08g32260.1 N frameshift_variant Average:8.17; most accessible tissue: Callus, score: 14.767 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819989626 NA 1.02E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.38E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 4.75E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 2.62E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 3.34E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 9.55E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 3.34E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 6.82E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 9.37E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 6.77E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 1.79E-06 5.10E-25 mr1627 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 4.54E-13 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 5.09E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 5.87E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.20E-10 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.01E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.26E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.04E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 4.47E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 6.40E-23 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.00E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.45E-37 mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.17E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.02E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.84E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 NA 1.30E-22 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819989626 6.16E-06 8.63E-28 mr1708_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251