\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819984645:

Variant ID: vg0819984645 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19984645
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGTTTCCATCCATAAAACTTAATATCTTATGTCCTGAAGCAGCATCAACCAACTGATCGGCCACTGGCATTGGATATTCGTCCTTTAGGGTAGCTTTA[T/C]
TCAAATCTCTAAAATCAATGCACACCCTCACCTTGCCATTCTTCTTGATAACAGGAACTATGCTAGAAACCCACTCGGCATATCGGCAAGGACGAATAAA

Reverse complement sequence

TTTATTCGTCCTTGCCGATATGCCGAGTGGGTTTCTAGCATAGTTCCTGTTATCAAGAAGAATGGCAAGGTGAGGGTGTGCATTGATTTTAGAGATTTGA[A/G]
TAAAGCTACCCTAAAGGACGAATATCCAATGCCAGTGGCCGATCAGTTGGTTGATGCTGCTTCAGGACATAAGATATTAAGTTTTATGGATGGAAACTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.10% 30.90% 4.87% 17.20% NA
All Indica  2759 19.20% 51.30% 7.43% 22.04% NA
All Japonica  1512 94.20% 0.90% 0.66% 4.17% NA
Aus  269 43.10% 6.30% 4.09% 46.47% NA
Indica I  595 20.70% 10.40% 6.05% 62.86% NA
Indica II  465 12.70% 70.30% 10.32% 6.67% NA
Indica III  913 17.30% 69.90% 6.57% 6.24% NA
Indica Intermediate  786 24.20% 49.50% 7.76% 18.58% NA
Temperate Japonica  767 99.10% 0.30% 0.00% 0.65% NA
Tropical Japonica  504 88.10% 1.80% 1.59% 8.53% NA
Japonica Intermediate  241 91.70% 1.20% 0.83% 6.22% NA
VI/Aromatic  96 93.80% 2.10% 1.04% 3.12% NA
Intermediate  90 70.00% 11.10% 3.33% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819984645 T -> C LOC_Os08g32260.1 missense_variant ; p.Asn937Ser; MODERATE nonsynonymous_codon Average:13.153; most accessible tissue: Zhenshan97 panicle, score: 20.424 possibly damaging 1.514 DELETERIOUS 0.00
vg0819984645 T -> DEL LOC_Os08g32260.1 N frameshift_variant Average:13.153; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819984645 NA 9.74E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 1.08E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 4.13E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 4.77E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 2.25E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 1.61E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 5.49E-06 mr1245_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 4.88E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 9.33E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 3.15E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 9.81E-07 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 6.37E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 9.20E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 1.23E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 9.23E-12 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 2.58E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 4.33E-08 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 5.23E-09 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 7.50E-07 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 8.26E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 3.10E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 2.38E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 3.15E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 1.52E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 1.83E-08 mr1492_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 2.76E-06 mr1492_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 7.15E-09 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 5.48E-07 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 2.40E-08 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 5.61E-06 mr1508_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 6.76E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 1.76E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 8.63E-07 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 6.57E-08 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 4.44E-08 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819984645 NA 8.72E-08 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251