\
| Variant ID: vg0819975886 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19975886 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCGATGCTGGCTCTCTCTGGATTGTTTCAAATTTCTAACAATCTTGACAACCCTTATAATATCTGAAACAATCCTCCAACATTGTCGGCCAAAAATATC[C/T,A]
AGCACGTCGAAGCAGCCATTTCATTTTATGAGCCGATTGATGAGTACCACATATCCCTTCATGAACTTCACCGATTGCAACTTTTACCTGATCGATACTC
GAGTATCGATCAGGTAAAAGTTGCAATCGGTGAAGTTCATGAAGGGATATGTGGTACTCATCAATCGGCTCATAAAATGAAATGGCTGCTTCGACGTGCT[G/A,T]
GATATTTTTGGCCGACAATGTTGGAGGATTGTTTCAGATATTATAAGGGTTGTCAAGATTGTTAGAAATTTGAAACAATCCAGAGAGAGCCAGCATCGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.20% | 16.70% | 17.86% | 28.99% | A: 0.21% |
| All Indica | 2759 | 34.50% | 0.70% | 27.91% | 36.57% | A: 0.33% |
| All Japonica | 1512 | 45.50% | 48.10% | 1.06% | 5.36% | NA |
| Aus | 269 | 8.60% | 0.70% | 13.01% | 77.32% | A: 0.37% |
| Indica I | 595 | 6.70% | 1.30% | 23.53% | 68.40% | NA |
| Indica II | 465 | 28.80% | 0.60% | 23.66% | 46.24% | A: 0.65% |
| Indica III | 913 | 58.50% | 0.40% | 28.92% | 11.61% | A: 0.55% |
| Indica Intermediate | 786 | 30.90% | 0.60% | 32.57% | 35.75% | A: 0.13% |
| Temperate Japonica | 767 | 61.40% | 37.70% | 0.13% | 0.78% | NA |
| Tropical Japonica | 504 | 17.10% | 70.00% | 2.38% | 10.52% | NA |
| Japonica Intermediate | 241 | 54.40% | 35.30% | 1.24% | 9.13% | NA |
| VI/Aromatic | 96 | 18.80% | 24.00% | 10.42% | 46.88% | NA |
| Intermediate | 90 | 35.60% | 20.00% | 14.44% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819975886 | C -> T | LOC_Os08g32230.1 | upstream_gene_variant ; 102.0bp to feature; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> T | LOC_Os08g32220.1 | downstream_gene_variant ; 1472.0bp to feature; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> T | LOC_Os08g32240.1 | downstream_gene_variant ; 448.0bp to feature; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> T | LOC_Os08g32250.1 | downstream_gene_variant ; 3287.0bp to feature; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> T | LOC_Os08g32230-LOC_Os08g32240 | intergenic_region ; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> A | LOC_Os08g32230.1 | upstream_gene_variant ; 102.0bp to feature; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> A | LOC_Os08g32220.1 | downstream_gene_variant ; 1472.0bp to feature; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> A | LOC_Os08g32240.1 | downstream_gene_variant ; 448.0bp to feature; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> A | LOC_Os08g32250.1 | downstream_gene_variant ; 3287.0bp to feature; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> A | LOC_Os08g32230-LOC_Os08g32240 | intergenic_region ; MODIFIER | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| vg0819975886 | C -> DEL | N | N | silent_mutation | Average:5.486; most accessible tissue: Callus, score: 9.012 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819975886 | NA | 1.14E-06 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819975886 | NA | 1.45E-06 | mr1228_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819975886 | NA | 2.28E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819975886 | NA | 1.79E-09 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819975886 | NA | 7.83E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819975886 | 1.49E-07 | 1.68E-26 | mr1551_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819975886 | 8.01E-06 | 1.26E-10 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819975886 | NA | 4.89E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819975886 | NA | 1.19E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819975886 | NA | 4.62E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |