Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819975886:

Variant ID: vg0819975886 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19975886
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCGATGCTGGCTCTCTCTGGATTGTTTCAAATTTCTAACAATCTTGACAACCCTTATAATATCTGAAACAATCCTCCAACATTGTCGGCCAAAAATATC[C/T,A]
AGCACGTCGAAGCAGCCATTTCATTTTATGAGCCGATTGATGAGTACCACATATCCCTTCATGAACTTCACCGATTGCAACTTTTACCTGATCGATACTC

Reverse complement sequence

GAGTATCGATCAGGTAAAAGTTGCAATCGGTGAAGTTCATGAAGGGATATGTGGTACTCATCAATCGGCTCATAAAATGAAATGGCTGCTTCGACGTGCT[G/A,T]
GATATTTTTGGCCGACAATGTTGGAGGATTGTTTCAGATATTATAAGGGTTGTCAAGATTGTTAGAAATTTGAAACAATCCAGAGAGAGCCAGCATCGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.20%	16.70%	17.86%	28.99%	A: 0.21%
All Indica	2759	34.50%	0.70%	27.91%	36.57%	A: 0.33%
All Japonica	1512	45.50%	48.10%	1.06%	5.36%	NA
Aus	269	8.60%	0.70%	13.01%	77.32%	A: 0.37%
Indica I	595	6.70%	1.30%	23.53%	68.40%	NA
Indica II	465	28.80%	0.60%	23.66%	46.24%	A: 0.65%
Indica III	913	58.50%	0.40%	28.92%	11.61%	A: 0.55%
Indica Intermediate	786	30.90%	0.60%	32.57%	35.75%	A: 0.13%
Temperate Japonica	767	61.40%	37.70%	0.13%	0.78%	NA
Tropical Japonica	504	17.10%	70.00%	2.38%	10.52%	NA
Japonica Intermediate	241	54.40%	35.30%	1.24%	9.13%	NA
VI/Aromatic	96	18.80%	24.00%	10.42%	46.88%	NA
Intermediate	90	35.60%	20.00%	14.44%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819975886	C -> T	LOC_Os08g32230.1	upstream_gene_variant ; 102.0bp to feature; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> T	LOC_Os08g32220.1	downstream_gene_variant ; 1472.0bp to feature; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> T	LOC_Os08g32240.1	downstream_gene_variant ; 448.0bp to feature; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> T	LOC_Os08g32250.1	downstream_gene_variant ; 3287.0bp to feature; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> T	LOC_Os08g32230-LOC_Os08g32240	intergenic_region ; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> A	LOC_Os08g32230.1	upstream_gene_variant ; 102.0bp to feature; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> A	LOC_Os08g32220.1	downstream_gene_variant ; 1472.0bp to feature; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> A	LOC_Os08g32240.1	downstream_gene_variant ; 448.0bp to feature; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> A	LOC_Os08g32250.1	downstream_gene_variant ; 3287.0bp to feature; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> A	LOC_Os08g32230-LOC_Os08g32240	intergenic_region ; MODIFIER	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N
vg0819975886	C -> DEL	N	N	silent_mutation	Average:5.486; most accessible tissue: Callus, score: 9.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819975886	NA	1.14E-06	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886	NA	1.45E-06	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886	NA	2.28E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886	NA	1.79E-09	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886	NA	7.83E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886	1.49E-07	1.68E-26	mr1551_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886	8.01E-06	1.26E-10	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886	NA	4.89E-06	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886	NA	1.19E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886	NA	4.62E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251