\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819975886:

Variant ID: vg0819975886 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19975886
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGATGCTGGCTCTCTCTGGATTGTTTCAAATTTCTAACAATCTTGACAACCCTTATAATATCTGAAACAATCCTCCAACATTGTCGGCCAAAAATATC[C/T,A]
AGCACGTCGAAGCAGCCATTTCATTTTATGAGCCGATTGATGAGTACCACATATCCCTTCATGAACTTCACCGATTGCAACTTTTACCTGATCGATACTC

Reverse complement sequence

GAGTATCGATCAGGTAAAAGTTGCAATCGGTGAAGTTCATGAAGGGATATGTGGTACTCATCAATCGGCTCATAAAATGAAATGGCTGCTTCGACGTGCT[G/A,T]
GATATTTTTGGCCGACAATGTTGGAGGATTGTTTCAGATATTATAAGGGTTGTCAAGATTGTTAGAAATTTGAAACAATCCAGAGAGAGCCAGCATCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.20% 16.70% 17.86% 28.99% A: 0.21%
All Indica  2759 34.50% 0.70% 27.91% 36.57% A: 0.33%
All Japonica  1512 45.50% 48.10% 1.06% 5.36% NA
Aus  269 8.60% 0.70% 13.01% 77.32% A: 0.37%
Indica I  595 6.70% 1.30% 23.53% 68.40% NA
Indica II  465 28.80% 0.60% 23.66% 46.24% A: 0.65%
Indica III  913 58.50% 0.40% 28.92% 11.61% A: 0.55%
Indica Intermediate  786 30.90% 0.60% 32.57% 35.75% A: 0.13%
Temperate Japonica  767 61.40% 37.70% 0.13% 0.78% NA
Tropical Japonica  504 17.10% 70.00% 2.38% 10.52% NA
Japonica Intermediate  241 54.40% 35.30% 1.24% 9.13% NA
VI/Aromatic  96 18.80% 24.00% 10.42% 46.88% NA
Intermediate  90 35.60% 20.00% 14.44% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819975886 C -> T LOC_Os08g32230.1 upstream_gene_variant ; 102.0bp to feature; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> T LOC_Os08g32220.1 downstream_gene_variant ; 1472.0bp to feature; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> T LOC_Os08g32240.1 downstream_gene_variant ; 448.0bp to feature; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> T LOC_Os08g32250.1 downstream_gene_variant ; 3287.0bp to feature; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> T LOC_Os08g32230-LOC_Os08g32240 intergenic_region ; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> A LOC_Os08g32230.1 upstream_gene_variant ; 102.0bp to feature; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> A LOC_Os08g32220.1 downstream_gene_variant ; 1472.0bp to feature; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> A LOC_Os08g32240.1 downstream_gene_variant ; 448.0bp to feature; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> A LOC_Os08g32250.1 downstream_gene_variant ; 3287.0bp to feature; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> A LOC_Os08g32230-LOC_Os08g32240 intergenic_region ; MODIFIER silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N
vg0819975886 C -> DEL N N silent_mutation Average:5.486; most accessible tissue: Callus, score: 9.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819975886 NA 1.14E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886 NA 1.45E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886 NA 2.28E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886 NA 1.79E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886 NA 7.83E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886 1.49E-07 1.68E-26 mr1551_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886 8.01E-06 1.26E-10 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886 NA 4.89E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886 NA 1.19E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819975886 NA 4.62E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251