\
| Variant ID: vg0819968714 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19968714 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, A: 0.15, others allele: 0.00, population size: 72. )
AAAGCCGGTGCTGGTGGGCGGTCTGACTGATCTGCACATTGAACTGCCACATTCTGCTTCGAACTGATTGATTGACTGGTTGATCGAACCTGCACGATTG[C/A]
ACTGGCTGGATTCGACCTTTCTGTTCCTTTGCTTTGCCAAAACTGGACCGACTGGTTCTGCTTGAACTGACCTAGGCCAGAACTGCGGATACTCCTGAAA
TTTCAGGAGTATCCGCAGTTCTGGCCTAGGTCAGTTCAAGCAGAACCAGTCGGTCCAGTTTTGGCAAAGCAAAGGAACAGAAAGGTCGAATCCAGCCAGT[G/T]
CAATCGTGCAGGTTCGATCAACCAGTCAATCAATCAGTTCGAAGCAGAATGTGGCAGTTCAATGTGCAGATCAGTCAGACCGCCCACCAGCACCGGCTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 17.60% | 23.11% | 7.09% | NA |
| All Indica | 2759 | 68.20% | 4.10% | 27.04% | 0.69% | NA |
| All Japonica | 1512 | 27.40% | 45.30% | 7.41% | 19.84% | NA |
| Aus | 269 | 32.70% | 2.20% | 60.22% | 4.83% | NA |
| Indica I | 595 | 73.10% | 2.40% | 22.52% | 2.02% | NA |
| Indica II | 465 | 82.20% | 3.40% | 14.41% | 0.00% | NA |
| Indica III | 913 | 61.80% | 4.80% | 33.19% | 0.22% | NA |
| Indica Intermediate | 786 | 63.60% | 5.00% | 30.79% | 0.64% | NA |
| Temperate Japonica | 767 | 9.60% | 62.10% | 4.56% | 23.73% | NA |
| Tropical Japonica | 504 | 59.90% | 12.70% | 11.31% | 16.07% | NA |
| Japonica Intermediate | 241 | 16.20% | 60.20% | 8.30% | 15.35% | NA |
| VI/Aromatic | 96 | 41.70% | 5.20% | 53.12% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 24.40% | 23.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819968714 | C -> A | LOC_Os08g32210.1 | missense_variant ; p.Cys255Phe; MODERATE | nonsynonymous_codon ; C255F | Average:10.55; most accessible tissue: Callus, score: 31.983 | unknown | unknown | TOLERATED | 1.00 |
| vg0819968714 | C -> DEL | LOC_Os08g32210.1 | N | frameshift_variant | Average:10.55; most accessible tissue: Callus, score: 31.983 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819968714 | NA | 8.05E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819968714 | NA | 2.94E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819968714 | 1.51E-06 | 1.51E-06 | mr1207_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819968714 | NA | 2.31E-06 | mr1228_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819968714 | NA | 1.25E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819968714 | NA | 2.17E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819968714 | NA | 1.84E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819968714 | 3.19E-06 | 2.57E-08 | mr1765_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819968714 | NA | 9.03E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |