\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819961570:

Variant ID: vg0819961570 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19961570
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.08, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTAGACAATCAAGCCGCTGGATGTTTCATAGAGTGGTAGATATCTTATACAATCCAAGCTAACGTCGCTATTTAACCTAATCGGCCGCCTTCTACTAG[T/C,G]
AGATGTTAGCCGATTGTAGGTTAGATGACGATATTACTGAAGATTATACGAGATATATGATAACTTGACGAATTACATAAACAATATTAGAGTGTCATAA

Reverse complement sequence

TTATGACACTCTAATATTGTTTATGTAATTCGTCAAGTTATCATATATCTCGTATAATCTTCAGTAATATCGTCATCTAACCTACAATCGGCTAACATCT[A/G,C]
CTAGTAGAAGGCGGCCGATTAGGTTAAATAGCGACGTTAGCTTGGATTGTATAAGATATCTACCACTCTATGAAACATCCAGCGGCTTGATTGTCTAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 15.10% 36.27% 6.31% G: 0.02%
All Indica  2759 40.80% 1.30% 47.99% 9.89% NA
All Japonica  1512 51.50% 42.60% 5.75% 0.07% G: 0.07%
Aus  269 13.80% 0.70% 82.90% 2.60% NA
Indica I  595 48.60% 1.20% 48.24% 2.02% NA
Indica II  465 59.40% 2.40% 32.04% 6.24% NA
Indica III  913 24.80% 0.30% 61.66% 13.25% NA
Indica Intermediate  786 42.50% 2.00% 41.35% 14.12% NA
Temperate Japonica  767 38.20% 61.40% 0.39% 0.00% NA
Tropical Japonica  504 77.60% 9.30% 13.10% 0.00% NA
Japonica Intermediate  241 39.40% 52.30% 7.47% 0.41% G: 0.41%
VI/Aromatic  96 30.20% 5.20% 53.12% 11.46% NA
Intermediate  90 34.40% 26.70% 32.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819961570 T -> G LOC_Os08g32190.1 upstream_gene_variant ; 956.0bp to feature; MODIFIER silent_mutation Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0819961570 T -> G LOC_Os08g32180.1 downstream_gene_variant ; 1179.0bp to feature; MODIFIER silent_mutation Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0819961570 T -> G LOC_Os08g32180-LOC_Os08g32190 intergenic_region ; MODIFIER silent_mutation Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0819961570 T -> C LOC_Os08g32190.1 upstream_gene_variant ; 956.0bp to feature; MODIFIER silent_mutation Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0819961570 T -> C LOC_Os08g32180.1 downstream_gene_variant ; 1179.0bp to feature; MODIFIER silent_mutation Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0819961570 T -> C LOC_Os08g32180-LOC_Os08g32190 intergenic_region ; MODIFIER silent_mutation Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0819961570 T -> DEL N N silent_mutation Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819961570 NA 3.08E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 7.80E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 9.42E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 1.32E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 4.33E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 9.70E-06 9.68E-06 mr1207_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 7.79E-06 1.14E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 5.66E-07 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 1.27E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 1.17E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 1.89E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 5.51E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 9.04E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 4.18E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 3.70E-07 NA mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 9.45E-06 3.03E-11 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 2.72E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 4.81E-09 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 6.24E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 1.11E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 1.11E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 2.76E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 7.98E-06 NA mr1849_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 1.48E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 3.70E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 4.73E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 1.90E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 4.57E-06 NA mr1943_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 3.83E-19 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570 NA 4.64E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251