Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819961570:

Variant ID: vg0819961570 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19961570
Reference Allele: T	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.08, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTAGACAATCAAGCCGCTGGATGTTTCATAGAGTGGTAGATATCTTATACAATCCAAGCTAACGTCGCTATTTAACCTAATCGGCCGCCTTCTACTAG[T/C,G]
AGATGTTAGCCGATTGTAGGTTAGATGACGATATTACTGAAGATTATACGAGATATATGATAACTTGACGAATTACATAAACAATATTAGAGTGTCATAA

Reverse complement sequence

TTATGACACTCTAATATTGTTTATGTAATTCGTCAAGTTATCATATATCTCGTATAATCTTCAGTAATATCGTCATCTAACCTACAATCGGCTAACATCT[A/G,C]
CTAGTAGAAGGCGGCCGATTAGGTTAAATAGCGACGTTAGCTTGGATTGTATAAGATATCTACCACTCTATGAAACATCCAGCGGCTTGATTGTCTAGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	15.10%	36.27%	6.31%	G: 0.02%
All Indica	2759	40.80%	1.30%	47.99%	9.89%	NA
All Japonica	1512	51.50%	42.60%	5.75%	0.07%	G: 0.07%
Aus	269	13.80%	0.70%	82.90%	2.60%	NA
Indica I	595	48.60%	1.20%	48.24%	2.02%	NA
Indica II	465	59.40%	2.40%	32.04%	6.24%	NA
Indica III	913	24.80%	0.30%	61.66%	13.25%	NA
Indica Intermediate	786	42.50%	2.00%	41.35%	14.12%	NA
Temperate Japonica	767	38.20%	61.40%	0.39%	0.00%	NA
Tropical Japonica	504	77.60%	9.30%	13.10%	0.00%	NA
Japonica Intermediate	241	39.40%	52.30%	7.47%	0.41%	G: 0.41%
VI/Aromatic	96	30.20%	5.20%	53.12%	11.46%	NA
Intermediate	90	34.40%	26.70%	32.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819961570	T -> G	LOC_Os08g32190.1	upstream_gene_variant ; 956.0bp to feature; MODIFIER	silent_mutation	Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0819961570	T -> G	LOC_Os08g32180.1	downstream_gene_variant ; 1179.0bp to feature; MODIFIER	silent_mutation	Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0819961570	T -> G	LOC_Os08g32180-LOC_Os08g32190	intergenic_region ; MODIFIER	silent_mutation	Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0819961570	T -> C	LOC_Os08g32190.1	upstream_gene_variant ; 956.0bp to feature; MODIFIER	silent_mutation	Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0819961570	T -> C	LOC_Os08g32180.1	downstream_gene_variant ; 1179.0bp to feature; MODIFIER	silent_mutation	Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0819961570	T -> C	LOC_Os08g32180-LOC_Os08g32190	intergenic_region ; MODIFIER	silent_mutation	Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0819961570	T -> DEL	N	N	silent_mutation	Average:13.18; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819961570	NA	3.08E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	7.80E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	9.42E-06	mr1632	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	1.32E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	4.33E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	9.70E-06	9.68E-06	mr1207_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	7.79E-06	1.14E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	5.66E-07	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	1.27E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	1.17E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	1.89E-07	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	5.51E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	9.04E-09	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	4.18E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	3.70E-07	NA	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	9.45E-06	3.03E-11	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	2.72E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	4.81E-09	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	6.24E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	1.11E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	1.11E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	2.76E-12	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	7.98E-06	NA	mr1849_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	1.48E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	3.70E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	4.73E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	1.90E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	4.57E-06	NA	mr1943_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	3.83E-19	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819961570	NA	4.64E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251