RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0819943568:

Variant ID: vg0819943568 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19943568
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.04, T: 0.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

CACATCATCCTCCCATTCTTCACGGAAAACCGTTCTCGGTTTTTCCATATGGTGTTCTTCATATAGTCCATTCAAAATAACCTGTTTCATCCAATCAAAA[A/C]
TAGAGAAACTCGAAGTAGTGTGATTAGCAATAACATGTTTCTCTAAATTCGAACAAATGAAAACTCTATGCACCAAATATATTCCTCTATCATTATATTT

Reverse complement sequence

AAATATAATGATAGAGGAATATATTTGGTGCATAGAGTTTTCATTTGTTCGAATTTAGAGAAACATGTTATTGCTAATCACACTACTTCGAGTTTCTCTA[T/G]
TTTTGATTGGATGAAACAGGTTATTTTGAATGGACTATATGAAGAACACCATATGGAAAAACCGAGAACGGTTTTCCGTGAAGAATGGGAGGATGATGTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	16.60%	15.30%	27.78%	40.39%	NA
All Indica	2759	0.50%	1.60%	38.20%	59.70%	NA
All Japonica	1512	48.10%	42.50%	3.44%	5.89%	NA
Aus	269	0.70%	1.10%	58.36%	39.78%	NA
Indica I	595	1.20%	1.30%	28.91%	68.57%	NA
Indica II	465	0.40%	2.40%	38.28%	58.92%	NA
Indica III	913	0.10%	0.50%	45.35%	54.00%	NA
Indica Intermediate	786	0.40%	2.70%	36.90%	60.05%	NA
Temperate Japonica	767	37.90%	60.90%	0.26%	0.91%	NA
Tropical Japonica	504	69.60%	9.70%	8.13%	12.50%	NA
Japonica Intermediate	241	35.70%	52.70%	3.73%	7.88%	NA
VI/Aromatic	96	24.00%	5.20%	29.17%	41.67%	NA
Intermediate	90	18.90%	27.80%	24.44%	28.89%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819943568	A -> C	LOC_Os08g32140.1	missense_variant ; p.Ile430Ser; MODERATE	nonsynonymous_codon ; I430S	Average:5.207; most accessible tissue: Minghui63 flower, score: 10.335	possibly damaging	-1.518	TOLERATED	0.50
vg0819943568	A -> DEL	LOC_Os08g32140.1	N	frameshift_variant	Average:5.207; most accessible tissue: Minghui63 flower, score: 10.335	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819943568	NA	6.76E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819943568	NA	1.16E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819943568	NA	1.58E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819943568	NA	2.70E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819943568	NA	1.11E-12	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819943568	5.46E-06	1.04E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819943568	NA	5.46E-07	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819943568	NA	6.19E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819943568	NA	7.20E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819943568	NA	5.94E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 21 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0819943568:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact