\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819897831:

Variant ID: vg0819897831 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19897831
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TAGATAAAAACCACTATGCAAAAAACACCTTAGGTGGTTATATAAACGGTACTGTAAAGTTTAGGGGGTTTAATGTCCGGTTTCAAAGTTTAGAATGCTA[A/G]
ACGGACTTCCATCGAGAGTTTAGGGGGGTTATTTGGACTTTCTCCTTGTTTGGATGCTCAATAGGAATTGTAGGATCTTGGGACAGATTGACACGTTTTC

Reverse complement sequence

GAAAACGTGTCAATCTGTCCCAAGATCCTACAATTCCTATTGAGCATCCAAACAAGGAGAAAGTCCAAATAACCCCCCTAAACTCTCGATGGAAGTCCGT[T/C]
TAGCATTCTAAACTTTGAAACCGGACATTAAACCCCCTAAACTTTACAGTACCGTTTATATAACCACCTAAGGTGTTTTTTGCATAGTGGTTTTTATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.90% 0.08% 0.00% NA
All Indica  2759 64.40% 35.40% 0.14% 0.00% NA
All Japonica  1512 43.60% 56.40% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 74.50% 25.20% 0.34% 0.00% NA
Indica II  465 81.70% 18.30% 0.00% 0.00% NA
Indica III  913 50.60% 49.30% 0.11% 0.00% NA
Indica Intermediate  786 62.70% 37.20% 0.13% 0.00% NA
Temperate Japonica  767 15.10% 84.90% 0.00% 0.00% NA
Tropical Japonica  504 90.70% 9.30% 0.00% 0.00% NA
Japonica Intermediate  241 35.70% 64.30% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819897831 A -> G LOC_Os08g32090.1 downstream_gene_variant ; 738.0bp to feature; MODIFIER silent_mutation Average:69.225; most accessible tissue: Callus, score: 86.962 N N N N
vg0819897831 A -> G LOC_Os08g32080-LOC_Os08g32090 intergenic_region ; MODIFIER silent_mutation Average:69.225; most accessible tissue: Callus, score: 86.962 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819897831 A G -0.05 -0.05 -0.05 -0.04 -0.06 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819897831 NA 8.21E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819897831 NA 7.37E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819897831 NA 3.73E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819897831 8.73E-07 9.97E-09 mr1961 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819897831 NA 2.05E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819897831 NA 3.67E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819897831 NA 7.19E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251