\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819865994:

Variant ID: vg0819865994 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19865994
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.12, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


TATCTAACTAAGCTTTCTTACTCTGGATGTGGCGTGTATGAGTGTCTTCTCACTTCGCGACTTCAATTAGTCGTTTGAGTTATACACTCTCCCTAGCCCC[T/C]
AGCCTTGTCATCGGAGAATTCTTCTCAGAAGATAAGGCTCTTGGACCTTTGACCTGCCTCGGTTGAACAAGCACTGATCCTAGCCCCCAGCCATGAAGTT

Reverse complement sequence

AACTTCATGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCGAGGCAGGTCAAAGGTCCAAGAGCCTTATCTTCTGAGAAGAATTCTCCGATGACAAGGCT[A/G]
GGGGCTAGGGAGAGTGTATAACTCAAACGACTAATTGAAGTCGCGAAGTGAGAAGACACTCATACACGCCACATCCAGAGTAAGAAAGCTTAGTTAGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 33.10% 5.25% 0.00% NA
All Indica  2759 87.10% 4.30% 8.63% 0.00% NA
All Japonica  1512 8.90% 91.00% 0.07% 0.00% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 97.30% 1.20% 1.51% 0.00% NA
Indica II  465 89.20% 4.30% 6.45% 0.00% NA
Indica III  913 82.90% 6.50% 10.62% 0.00% NA
Indica Intermediate  786 82.80% 4.20% 12.98% 0.00% NA
Temperate Japonica  767 0.70% 99.20% 0.13% 0.00% NA
Tropical Japonica  504 20.00% 80.00% 0.00% 0.00% NA
Japonica Intermediate  241 12.00% 88.00% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 21.90% 3.12% 0.00% NA
Intermediate  90 52.20% 42.20% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819865994 T -> C LOC_Os08g32020.1 downstream_gene_variant ; 199.0bp to feature; MODIFIER silent_mutation Average:23.039; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0819865994 T -> C LOC_Os08g32030.1 downstream_gene_variant ; 416.0bp to feature; MODIFIER silent_mutation Average:23.039; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0819865994 T -> C LOC_Os08g32040.1 downstream_gene_variant ; 3604.0bp to feature; MODIFIER silent_mutation Average:23.039; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0819865994 T -> C LOC_Os08g32020-LOC_Os08g32030 intergenic_region ; MODIFIER silent_mutation Average:23.039; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819865994 NA 1.70E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 4.50E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 1.67E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 1.25E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 2.72E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 6.94E-06 6.94E-06 mr1270 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 1.74E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 7.59E-16 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 7.14E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 1.19E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 5.57E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 1.50E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 9.14E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 9.27E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 4.64E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 1.56E-17 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 6.22E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 5.59E-09 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 4.38E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 5.26E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 2.73E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 6.89E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 6.89E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 9.09E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 8.12E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 1.50E-15 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819865994 NA 6.49E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251