\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819864400:

Variant ID: vg0819864400 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19864400
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCTCACCTGGGAGTGCTCCAGGTCGAGATGGGGCGCCTCCTCGAGGCTGGCACTTGCGGCATTAGCCGCGAGATTGCGGAGGCGAGGGCGGCGGCGGC[G/A]
GCGTCGGCGAATGAGCGCTGACCGGCTGGCGCGCGATTTGGCGGAGGTTCGCGAGGACCTTCAGAAGATGCGGGAGCTGGTGGCTGGCAATGAGCGACAA

Reverse complement sequence

TTGTCGCTCATTGCCAGCCACCAGCTCCCGCATCTTCTGAAGGTCCTCGCGAACCTCCGCCAAATCGCGCGCCAGCCGGTCAGCGCTCATTCGCCGACGC[C/T]
GCCGCCGCCGCCCTCGCCTCCGCAATCTCGCGGCTAATGCCGCAAGTGCCAGCCTCGAGGAGGCGCCCCATCTCGACCTGGAGCACTCCCAGGTGAGGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 5.20% 5.21% 3.43% NA
All Indica  2759 83.90% 3.60% 6.89% 5.65% NA
All Japonica  1512 99.70% 0.10% 0.13% 0.00% NA
Aus  269 32.70% 48.00% 19.33% 0.00% NA
Indica I  595 82.70% 2.50% 13.78% 1.01% NA
Indica II  465 95.50% 1.30% 1.72% 1.51% NA
Indica III  913 83.40% 3.10% 3.61% 9.97% NA
Indica Intermediate  786 78.50% 6.40% 8.52% 6.62% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 7.30% 0.00% 4.17% NA
Intermediate  90 87.80% 7.80% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819864400 G -> A LOC_Os08g32020.1 missense_variant ; p.Arg438Gln; MODERATE nonsynonymous_codon ; R438H Average:41.687; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 unknown unknown TOLERATED 0.10
vg0819864400 G -> A LOC_Os08g32020.1 missense_variant ; p.Arg438Gln; MODERATE nonsynonymous_codon ; R438Q Average:41.687; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 unknown unknown TOLERATED 0.47
vg0819864400 G -> DEL LOC_Os08g32020.1 N frameshift_variant Average:41.687; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819864400 NA 5.54E-06 mr1136 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 6.48E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 1.00E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 7.02E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 7.75E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 1.88E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 6.75E-08 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 5.89E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 3.73E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 1.60E-06 4.58E-07 mr1768 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 7.74E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 1.72E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 1.60E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 8.91E-07 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400 NA 8.85E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251