Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819864400:

Variant ID: vg0819864400 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19864400
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCCTCACCTGGGAGTGCTCCAGGTCGAGATGGGGCGCCTCCTCGAGGCTGGCACTTGCGGCATTAGCCGCGAGATTGCGGAGGCGAGGGCGGCGGCGGC[G/A]
GCGTCGGCGAATGAGCGCTGACCGGCTGGCGCGCGATTTGGCGGAGGTTCGCGAGGACCTTCAGAAGATGCGGGAGCTGGTGGCTGGCAATGAGCGACAA

Reverse complement sequence

TTGTCGCTCATTGCCAGCCACCAGCTCCCGCATCTTCTGAAGGTCCTCGCGAACCTCCGCCAAATCGCGCGCCAGCCGGTCAGCGCTCATTCGCCGACGC[C/T]
GCCGCCGCCGCCCTCGCCTCCGCAATCTCGCGGCTAATGCCGCAAGTGCCAGCCTCGAGGAGGCGCCCCATCTCGACCTGGAGCACTCCCAGGTGAGGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.20%	5.20%	5.21%	3.43%	NA
All Indica	2759	83.90%	3.60%	6.89%	5.65%	NA
All Japonica	1512	99.70%	0.10%	0.13%	0.00%	NA
Aus	269	32.70%	48.00%	19.33%	0.00%	NA
Indica I	595	82.70%	2.50%	13.78%	1.01%	NA
Indica II	465	95.50%	1.30%	1.72%	1.51%	NA
Indica III	913	83.40%	3.10%	3.61%	9.97%	NA
Indica Intermediate	786	78.50%	6.40%	8.52%	6.62%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	7.30%	0.00%	4.17%	NA
Intermediate	90	87.80%	7.80%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819864400	G -> A	LOC_Os08g32020.1	missense_variant ; p.Arg438Gln; MODERATE	nonsynonymous_codon ; R438H	Average:41.687; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	unknown	unknown	TOLERATED	0.10
vg0819864400	G -> A	LOC_Os08g32020.1	missense_variant ; p.Arg438Gln; MODERATE	nonsynonymous_codon ; R438Q	Average:41.687; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	unknown	unknown	TOLERATED	0.47
vg0819864400	G -> DEL	LOC_Os08g32020.1	N	frameshift_variant	Average:41.687; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819864400	NA	5.54E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	6.48E-07	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	1.00E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	7.02E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	7.75E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	1.88E-08	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	6.75E-08	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	5.89E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	3.73E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	1.60E-06	4.58E-07	mr1768	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	7.74E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	1.72E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	1.60E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	8.91E-07	mr1823_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819864400	NA	8.85E-06	mr1824_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251