Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0819861761:

Variant ID: vg0819861761 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19861761
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATAATTAGTCACATATAAATTTATATTCATGTTTTATCGTCTAATAATAATAAAAATAATAATTATAAAAAAATTAAATAAGACGAACGATCAAACGT[C/T]
GAACATGAACGGTCTAAAACTACACTTATTTTGAGGGAGAGTGTCGACAGGGGATACTCGTAGACCAGATATAGAGGGTATTGGGGTACGCTGGTACGAG

Reverse complement sequence

CTCGTACCAGCGTACCCCAATACCCTCTATATCTGGTCTACGAGTATCCCCTGTCGACACTCTCCCTCAAAATAAGTGTAGTTTTAGACCGTTCATGTTC[G/A]
ACGTTTGATCGTTCGTCTTATTTAATTTTTTTATAATTATTATTTTTATTATTATTAGACGATAAAACATGAATATAAATTTATATGTGACTAATTATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.30%	14.20%	6.22%	9.31%	NA
All Indica	2759	75.30%	0.40%	9.50%	14.86%	NA
All Japonica	1512	55.60%	42.50%	1.79%	0.13%	NA
Aus	269	98.50%	0.40%	0.00%	1.12%	NA
Indica I	595	96.30%	0.30%	1.18%	2.18%	NA
Indica II	465	85.20%	0.40%	4.73%	9.68%	NA
Indica III	913	57.60%	0.10%	20.04%	22.23%	NA
Indica Intermediate	786	74.00%	0.60%	6.36%	18.96%	NA
Temperate Japonica	767	29.30%	67.80%	2.87%	0.00%	NA
Tropical Japonica	504	92.50%	7.30%	0.20%	0.00%	NA
Japonica Intermediate	241	62.20%	35.30%	1.66%	0.83%	NA
VI/Aromatic	96	78.10%	1.00%	1.04%	19.79%	NA
Intermediate	90	71.10%	17.80%	4.44%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819861761	C -> T	LOC_Os08g32010.1	upstream_gene_variant ; 2308.0bp to feature; MODIFIER	silent_mutation	Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0819861761	C -> T	LOC_Os08g32020.1	upstream_gene_variant ; 993.0bp to feature; MODIFIER	silent_mutation	Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0819861761	C -> T	LOC_Os08g32030.1	downstream_gene_variant ; 4649.0bp to feature; MODIFIER	silent_mutation	Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0819861761	C -> T	LOC_Os08g32010-LOC_Os08g32020	intergenic_region ; MODIFIER	silent_mutation	Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0819861761	C -> DEL	N	N	silent_mutation	Average:47.699; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819861761	NA	4.05E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	8.80E-07	8.80E-07	mr1200	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	1.41E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	3.69E-06	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	8.81E-11	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	6.02E-06	NA	mr1936	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	6.72E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	6.85E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	1.72E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	8.48E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	7.91E-09	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	1.10E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	2.02E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	2.17E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	2.61E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	2.18E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	1.09E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819861761	NA	2.93E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251