Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0819858633:

Variant ID: vg0819858633 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19858633
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCGCTGGGAAAGCTTGGGGAGGCCAGTGACTAAAGCTGGAAGCTGGTCTGCTATCGAGGTCACCGTGATCTCAGCTCCGTTAATGTTGCTAAGCTGCAG[G/A]
CAATGGAGGAAGCAGCCGAGGGCAGCTAGATCTGCAGATTGAGGAGTACTAGAGACAGTGACCATGCTTAGGGGCGGCCGGCCTTCACGGTGTCCGTCCG

Reverse complement sequence

CGGACGGACACCGTGAAGGCCGGCCGCCCCTAAGCATGGTCACTGTCTCTAGTACTCCTCAATCTGCAGATCTAGCTGCCCTCGGCTGCTTCCTCCATTG[C/T]
CTGCAGCTTAGCAACATTAACGGAGCTGAGATCACGGTGACCTCGATAGCAGACCAGCTTCCAGCTTTAGTCACTGGCCTCCCCAAGCTTTCCCAGCGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 17.60% 0.68% 13.71% NA
All Indica  2759 48.10% 28.40% 1.05% 22.40% NA
All Japonica  1512 99.60% 0.20% 0.00% 0.20% NA
Aus  269 87.40% 11.50% 0.00% 1.12% NA
Indica I  595 60.00% 37.30% 0.17% 2.52% NA
Indica II  465 82.60% 4.50% 0.86% 12.04% NA
Indica III  913 22.50% 35.80% 1.53% 40.20% NA
Indica Intermediate  786 48.60% 27.20% 1.27% 22.90% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 78.10% 2.10% 1.04% 18.75% NA
Intermediate  90 78.90% 12.20% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819858633 G -> A LOC_Os08g32010.1 synonymous_variant ; p.Cys30Cys; LOW synonymous_codon Average:47.471; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg0819858633 G -> DEL LOC_Os08g32010.1 N frameshift_variant Average:47.471; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819858633 G A -0.03 -0.02 -0.02 -0.02 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819858633 NA 1.60E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819858633 NA 1.78E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 2.62E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 4.77E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 2.03E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 1.72E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 3.11E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 8.10E-06 mr1474_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 1.21E-09 mr1566_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 8.04E-07 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 2.27E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 8.18E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 7.87E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 4.21E-08 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 8.07E-07 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 4.78E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 2.60E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 5.92E-07 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 8.31E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819858633 NA 3.10E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251